Morpholino
MO2-efnb2a
- ID
- ZDB-MRPHLNO-050712-3
- Name
- MO2-efnb2a
- Previous Names
-
- efnb2a MO (1)
- Target
- Sequence
-
5' - AATATCTCCACAAAGAGTCGCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-efnb2a
No data available
Phenotype
Phenotype resulting from MO2-efnb2a
Phenotype | Fish | Figures |
---|---|---|
blood circulation disrupted, abnormal | sd2Tg + MO2-efnb2a |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-efnb2a
1 - 5 of 25 Show all
Citations
- Baek, K.I., Chang, S.S., Chang, C.C., Roustaei, M., Ding, Y., Wang, Y., Chen, J., O'Donnell, R., Chen, H., Ashby, J.W., Xu, X., Mack, J.J., Cavallero, S., Roper, M., Hsiai, T.K. (2022) Vascular Injury in the Zebrafish Tail Modulates Blood Flow and Peak Wall Shear Stress to Restore Embryonic Circular Network. Frontiers in cardiovascular medicine. 9:841101
- Kawasaki, J., Aegerter, S., Fevurly, R.D., Mammoto, A., Mammoto, T., Sahin, M., Mably, J.D., Fishman, S.J., Chan, J. (2014) RASA1 functions in EPHB4 signaling pathway to suppress endothelial mTORC1 activity. J. Clin. Invest.. 124(6):2774-84
- Lackner, S., Schwendinger-Schreck, J., Jülich, D., and Holley, S.A. (2013) Segmental assembly of fibronectin matrix requires rap1b and integrin alpha5. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(2):122-131
- Jülich, D., Mould, A.P., Koper, E., and Holley, S.A. (2009) Control of extracellular matrix assembly along tissue boundaries via Integrin and Eph/Ephrin signaling. Development (Cambridge, England). 136(17):2913-2921
- Kemp, H.A., Cooke, J.E., and Moens, C.B. (2009) EphA4 and EfnB2a maintain rhombomere coherence by independently regulating intercalation of progenitor cells in the zebrafish neural keel. Developmental Biology. 327(2):313-326
- Pickart, M.A., Klee, E.W., Nielsen, A.L., Sivasubbu, S., Mendenhall, E.M., Bill B.R., Chen, E., Eckfeldt, C.E., Knowlton, M., Robu, M.E., Larson, J.D., Deng, Y., Schimmenti, L.A., Ellis, L.B., Verfaillie, C.M., Hammerschmidt, M., Farber, S.A., and Ekker, S.C. (2006) Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome. PLoS One. 1(1):e104
- Koshida, S., Kishimoto, Y., Ustumi, H., Shimizu, T., Furutani-Seiki, M., Kondoh, H., and Takada, S. (2005) Integrinalpha5-Dependent Fibronectin Accumulation for Maintenance of Somite Boundaries in Zebrafish Embryos. Developmental Cell. 8(4):587-598
1 - 7 of 7
Show