Morpholino
MO4-tal1
- ID
- ZDB-MRPHLNO-050527-2
- Name
- MO4-tal1
- Previous Names
- Target
- Sequence
-
5' - AATGCTCTTACCATCGTTGATTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets exon/intron boundary sequence of exon 3/intron 3.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tal1
No data available
Phenotype
Phenotype resulting from MO4-tal1
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO4-tal1
1 - 5 of 26 Show all
Citations
- Laverde, V., Loges, L., Sumanas, S. (2025) Zebrafish ETS transcription factor Fli1b functions upstream of Scl/Tal1 during embryonic hematopoiesis. Biology Open. :
- Capon, S.J., Uribe, V., Dominado, N., Ehrlich, O., Smith, K.A. (2022) Endocardial identity is established during early somitogenesis by Bmp signalling acting upstream of npas4l and etv2. Development (Cambridge, England). 149(9):
- Metikala, S., Warkala, M., Casie Chetty, S., Chestnut, B., Rufin Florat, D., Plender, E., Nester, O., Koenig, A.L., Astrof, S., Sumanas, S. (2022) Integration of vascular progenitors into functional blood vessels represents a distinct mechanism of vascular growth. Developmental Cell. 57(6):767-782.e6
- Chestnut, B., Casie Chetty, S., Koenig, A.L., Sumanas, S. (2020) Single-cell transcriptomic analysis identifies the conversion of zebrafish Etv2-deficient vascular progenitors into skeletal muscle. Nature communications. 11:2796
- Yin, H.M., Yan, L.F., Liu, Q., Peng, Z., Zhang, C.Y., Xia, Y., Su, D., Gu, A.H., Zhou, Y. (2020) Activating transcription factor 3 coordinates differentiation of cardiac and hematopoietic progenitors by regulating glucose metabolism. Science advances. 6:eaay9466
- Reischauer, S., Stone, O.A., Villasenor, A., Chi, N., Jin, S.W., Martin, M., Lee, M.T., Fukuda, N., Marass, M., Witty, A., Fiddes, I., Kuo, T., Chung, W.S., Salek, S., Lerrigo, R., Alsiö, J., Luo, S., Tworus, D., Augustine, S.M., Mucenieks, S., Nystedt, B., Giraldez, A.J., Schroth, G.P., Andersson, O., Stainier, D.Y. (2016) Cloche is a bHLH-PAS transcription factor that drives haemato-vascular specification. Nature. 535:294-8
- Hasegawa, T., Nakajima, T., Ishida, T., Kudo, A., Kawakami, A. (2015) A diffusible signal derived from hematopoietic cells supports the survival and proliferation of regenerative cells during zebrafish fin fold regeneration. Developmental Biology. 399(1):80-90
- Glenn, N.O., Schumacher, J.A., Kim, H.J., Zhao, E.J., Skerniskyte, J., Sumanas, S. (2014) Distinct regulation of the anterior and posterior myeloperoxidase expression by Etv2 and Gata1 during primitive Granulopoiesis in zebrafish. Developmental Biology. 393(1):149-59
- Schupp, M.O., Waas, M., Chun, C.Z., Ramchandran, R. (2014) Transcriptional inhibition of etv2 expression is essential for embryonic cardiac development. Developmental Biology. 393(1):71-83
- Simões, F.C., Peterkin, T., and Patient, R. (2011) Fgf differentially controls cross-antagonism between cardiac and haemangioblast regulators. Development (Cambridge, England). 138(15):3235-3245
1 - 10 of 21
Show