Morpholino
MO1-aldh1a2
- ID
- ZDB-MRPHLNO-050316-2
- Name
- MO1-aldh1a2
- Previous Names
-
- raldh2 MO
- Target
- Sequence
-
5' - GTTCAACTTCACTGGAGGTCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aldh1a2
No data available
Phenotype
Phenotype resulting from MO1-aldh1a2
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO1-aldh1a2
1 - 5 of 22 Show all
Citations
- Williams, A.L., Eason, J., Chawla, B., Bohnsack, B.L. (2017) Cyp1b1 Regulates Ocular Fissure Closure Through a Retinoic Acid-Independent Pathway. Investigative ophthalmology & visual science. 58:1084-1097
- Li, J., Yue, Y., Zhao, Q. (2016) Retinoic Acid Signaling Is Essential for Valvulogenesis by Affecting Endocardial Cushions Formation in Zebrafish Embryos. Zebrafish. 13(1):9-18
- Sosnik, J., Zheng, L., Rackauckas, C.V., Digman, M., Gratton, E., Nie, Q., Schilling, T.F. (2016) Noise modulation in retinoic acid signaling sharpens segmental boundaries of gene expression in the embryonic zebrafish hindbrain. eLIFE. 5:e14034
- Retnoaji, B., Akiyama, R., Matta, T., Bessho, Y., and Matsui, T. (2014) Retinoic acid controls proper head-to-trunk linkage in zebrafish by regulating an anteroposterior somitogenetic rate difference. Development (Cambridge, England). 141(1):158-165
- Bohnsack, B.L., Kasprick, D.S., Kish, P.E., Goldman, D., and Kahana, A. (2012) A zebrafish model of Axenfeld-Rieger Syndrome reveals that pitx2 regulation by retinoic acid is essential for ocular and craniofacial development. Investigative ophthalmology & visual science. 53(1):7-22
- Vaccari, E., Deflorian, G., Bernardi, E., Pauls, S., Tiso, N., Bortolussi, M., and Argenton, F. (2010) prep1.2 and aldh1a2 participate to a positive loop required for branchial arches development in zebrafish. Developmental Biology. 343(1-2):94-103
- Laue, K., Jänicke, M., Plaster, N., Sonntag, C., and Hammerschmidt, M. (2008) Restriction of retinoic acid activity by Cyp26b1 is required for proper timing and patterning of osteogenesis during zebrafish development. Development (Cambridge, England). 135(22):3775-3787
- Eisinger, A.L., Nadauld, L.D., Shelton, D.N., Prescott, S.M., Stafforini, D.M., and Jones, D.A. (2007) Retinoic Acid Inhibits β-Catenin through Suppression of Cox-2: A role for truncated adenomatous polyposis coli. The Journal of biological chemistry. 282(40):29394-29400
- White, R.J., Nie, Q., Lander, A.D., and Schilling, T.F. (2007) Complex Regulation of cyp26a1 Creates a Robust Retinoic Acid Gradient in the Zebrafish Embryo. PLoS Biology. 5(11):e304
- Emoto, Y., Wada, H., Okamoto, H., Kudo, A., and Imai, Y. (2005) Retinoic acid-metabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Developmental Biology. 278(2):415-427
1 - 10 of 13
Show