Morpholino
MO1-tp53
- ID
- ZDB-MRPHLNO-050107-3
- Name
- MO1-tp53
- Previous Names
-
- MO p53 (1)
- MO1-p53
- Target
- Sequence
-
5' - AGAATTGATTTTGCCGACCTCCTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tp53
No data available
Phenotype
Phenotype resulting from MO1-tp53
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-tp53
1 - 5 of 80 Show all
Citations
- Ercanbrack, W.S., Dungan, A., Gaul, E., Ramirez, M., J DelVecchio, A., Grass, C., Wingert, R.A. (2024) Frataxin is essential for zebrafish embryogenesis and pronephros formation. Frontiers in cell and developmental biology. 12:14962441496244
- Lawir, D.F., Soza-Ried, C., Iwanami, N., Siamishi, I., Bylund, G.O., O Meara, C., Sikora, K., Kanzler, B., Johansson, E., Schorpp, M., Cauchy, P., Boehm, T. (2024) Antagonistic interactions safeguard mitotic propagation of genetic and epigenetic information in zebrafish. Communications biology. 7:3131
- Volpatti, J.R., Ghahramani-Seno, M.M., Mansat, M., Sabha, N., Sarikaya, E., Goodman, S.J., Chater-Diehl, E., Celik, A., Pannia, E., Froment, C., Combes-Soia, L., Maani, N., Yuki, K.E., Chicanne, G., Uusküla-Reimand, L., Monis, S., Alvi, S.A., Genetti, C.A., Payrastre, B., Beggs, A.H., Bonnemann, C.G., Muntoni, F., Wilson, M.D., Weksberg, R., Viaud, J., Dowling, J.J. (2022) X-linked myotubular myopathy is associated with epigenetic alterations and is ameliorated by HDAC inhibition. Acta Neuropathologica. 144(3):537-563
- Park, S., Oh, J., Kim, Y.I., Choe, S.K., Chun, C.H., Jin, E.J. (2018) Suppression of ABCD2 dysregulates lipid metabolism via dysregulation of miR-141:ACSL4 in human osteoarthritis. Cell biochemistry and function. 36(7):366-376
- Casano, A.M., Albert, M., Peri, F. (2016) Developmental Apoptosis Mediates Entry and Positioning of Microglia in the Zebrafish Brain. Cell Reports. 16(4):897-906
- Cheng, C.N., Wingert, R.A. (2015) Nephron proximal tubule patterning and corpuscles of Stannius formation are regulated by the sim1a transcription factor and retinoic acid in zebrafish. Developmental Biology. 399(1):100-16
- Schwamb, B., Pick, R., Fernández, S.B., Völp, K., Heering, J., Dötsch, V., Bösser, S., Jung, J., Beinoraviciute-Kellner, R., Wesely, J., Zörnig, I., Hammerschmidt, M., Nowak, M., Penzel, R., Zatloukal, K., Joos, S., Rieker, R.J., Agaimy, A., Söder, S., Reid-Lombardo, K., Kendrick, M.L., Bardsley, M.R., Hayashi, Y., Asuzu, D.T., Syed, S.A., Ordog, T., Zörnig, M. (2015) FAM96A is a novel pro-apoptotic tumor suppressor in gastrointestinal stromal tumors. International Journal of Cancer. 137(6):1318-1329
- Subramanian, A., Schilling, T.F. (2014) Thrombospondin-4 controls matrix assembly during development and repair of myotendinous junctions. eLIFE. 6(8):e02372
- Tuttle, A.M., Hoffman, T.L., Schilling, T.F. (2014) Rabconnectin-3a regulates vesicle endocytosis and canonical Wnt signaling in zebrafish neural crest migration. PLoS Biology. 12:e1001852
- Chen, C.F., Chu, C.Y., Chen, T.H., Lee, S.J., Shen, C.N., and Hsiao, C.D. (2011) Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo. PLoS One. 6(5):e20654
1 - 10 of 20
Show