Morpholino
MO1-notch3
- ID
- ZDB-MRPHLNO-041207-7
- Name
- MO1-notch3
- Previous Names
-
- MO-notch3-1 (1)
- Target
- Sequence
-
5' - ATATCCAAAGGCTGTAATTCCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed to bind to 5'-end of gene
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch3
No data available
Phenotype
Phenotype resulting from MO1-notch3
No data available
Phenotype of all Fish created by or utilizing MO1-notch3
1 - 5 of 28 Show all
Citations
- Sahu, A., Devi, S., Jui, J., Goldman, D. (2021) Notch signaling via Hey1 and Id2b regulates Müller glia's regenerative response to retinal injury. Glia. 69(12):2882-2898
- Ando, K., Wang, W., Peng, D., Chiba, A., Lagendijk, A., Barske, L., Crump, J.G., Stainier, D.Y.R., Lendahl, U., Koltowska, K., Hogan, B.M., Fukuhara, S., Mochizuki, N., Betsholtz, C. (2019) Peri-arterial specification of vascular mural cells from naïve mesenchyme requires Notch signaling. Development (Cambridge, England). 146(2):
- Chen, X., Gays, D., Milia, C., Santoro, M.M. (2017) Cilia Control Vascular Mural Cell Recruitment in Vertebrates. Cell Reports. 18:1033-1047
- Kressmann, S., Campos, C., Castanon, I., Fürthauer, M., González-Gaitán, M. (2015) Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. Nature cell biology. 17(3):333-9
- Wang, Y., Pan, L., Moens, C.B., and Appel, B. (2014) Notch3 establishes brain vascular integrity by regulating pericyte number. Development (Cambridge, England). 141(2):307-317
- Da'as, S.I., Coombs, A.J., Balci, T.B., Grondin, C.A., Ferrando, A.A., and Berman, J.N. (2012) The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood. 119(15):3585-3594
- Geudens, I., Herpers, R., Hermans, K., Segura, I., Ruiz de Almodovar, C., Bussmann, J., De Smet, F., Vandevelde, W., Hogan, B.M., Siekmann, A., Claes, F., Moore, J.C., Pistocchi, A.S., Loges, S., Mazzone, M., Mariggi, G., Bruyere, F., Cotelli, F., Kerjaschki, D., Noel, A., Foidart, J.M., Gerhardt, H., Ny, A., Langenberg, T., Lawson, N.D., Duckers, H.J., Schulte-Merker, S., Carmeliet, P., and Dewerchin, M. (2010) Role of delta-like-4/Notch in the formation and wiring of the lymphatic network in zebrafish. Arterioscler. Thromb. Vasc. Biol.. 30(9):1695-1702
- Ishitani, T., Hirao, T., Suzuki, M., Isoda, M., Ishitani, S., Harigaya, K., Kitagawa, M., Matsumoto, K., and Itoh, M. (2010) Nemo-like kinase suppresses Notch signalling by interfering with formation of the Notch active transcriptional complex. Nature cell biology. 12(3):278-285
- Matsuda, M., and Chitnis, A.B. (2010) Atoh1a expression must be restricted by Notch signaling for effective morphogenesis of the posterior lateral line primordium in zebrafish. Development (Cambridge, England). 137(20):3477-3487
- Matsuda, M., and Chitnis, A.B. (2009) Interaction with Notch determines endocytosis of specific Delta ligands in zebrafish neural tissue. Development (Cambridge, England). 136(2):197-206
1 - 10 of 17
Show