Morpholino
MO1-jag2b
- ID
- ZDB-MRPHLNO-041207-2
- Name
- MO1-jag2b
- Previous Names
- Target
- Sequence
-
5' - TCCTGATACAATTCCACATGCCGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed to bind 5'-end of gene
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jag2b
No data available
Phenotype
Phenotype resulting from MO1-jag2b
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-jag2b
1 - 5 of 10 Show all
Citations
- Jacobs, C.T., Kejriwal, A., Kocha, K.M., Jin, K.Y., Huang, P. (2022) Temporal cell fate determination in the spinal cord is mediated by the duration of Notch signalling. Developmental Biology. 489:1-13
- Wada, Y., Tsukatani, H., Kuroda, C., Miyazaki, Y., Otoshi, M., Kobayashi, I. (2022) Jagged 2b induces intercellular signaling within somites to establish hematopoietic stem cell fate in zebrafish. Development (Cambridge, England). 149(7)
- Zhao, C., Matalonga, J., Lancman, J.J., Liu, L., Xiao, C., Kumar, S., Gates, K.P., He, J., Graves, A., Huisken, J., Azuma, M., Lu, Z., Chen, C., Ding, B.S., Dong, P.D.S. (2022) Regenerative failure of intrahepatic biliary cells in Alagille syndrome rescued by elevated Jagged/Notch/Sox9 signaling. Proceedings of the National Academy of Sciences of the United States of America. 119:e2201097119e2201097119
- Zhao, C., Lancman, J.J., Yang, Y., Gates, K.P., Cao, D., Barske, L., Matalonga, J., Pan, X., He, J., Graves, A., Huisken, J., Chen, C., Dong, P.D.S. (2021) Intrahepatic cholangiocyte regeneration from an Fgf-dependent extrahepatic progenitor niche in a zebrafish model of Alagille Syndrome. Hepatology (Baltimore, Md.). 75(3):567-583
- Zhang, D., Gates, K.P., Barske, L., Wang, G., Lancman, J.J., Zeng, X.I., Groff, M., Wang, K., Parsons, M.J., Crump, J.G., Dong, P.D.S. (2017) Endoderm Jagged induces liver and pancreas duct lineage in zebrafish. Nature communications. 8:769
- Pascoal, S., Esteves de Lima, J., Leslie, J.D., Hughes, S.M., and Saúde, L. (2013) Notch signalling is required for the formation of structurally stable muscle fibres in zebrafish. PLoS One. 8(6):e68021
- Geudens, I., Herpers, R., Hermans, K., Segura, I., Ruiz de Almodovar, C., Bussmann, J., De Smet, F., Vandevelde, W., Hogan, B.M., Siekmann, A., Claes, F., Moore, J.C., Pistocchi, A.S., Loges, S., Mazzone, M., Mariggi, G., Bruyere, F., Cotelli, F., Kerjaschki, D., Noel, A., Foidart, J.M., Gerhardt, H., Ny, A., Langenberg, T., Lawson, N.D., Duckers, H.J., Schulte-Merker, S., Carmeliet, P., and Dewerchin, M. (2010) Role of delta-like-4/Notch in the formation and wiring of the lymphatic network in zebrafish. Arterioscler. Thromb. Vasc. Biol.. 30(9):1695-1702
- Bill, B.R., Balciunas, D., McCarra, J.A., Young, E.D., Xiong, T., Spahn, A.M., Garcia-Lecea, M., Korzh, V., Ekker, S.C., and Schimmenti, L.A. (2008) Development and notch signaling requirements of the zebrafish choroid plexus. PLoS One. 3(9):e3114
- Jänicke, M., Carney, T.J., and Hammerschmidt, M. (2007) Foxi3 transcription factors and Notch signaling control the formation of skin ionocytes from epidermal precursors of the zebrafish embryo. Developmental Biology. 307(2):258-271
- Liu, Y., Pathak, N., Kramer-Zucker, A., and Drummond, I.A. (2007) Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development (Cambridge, England). 134(6):1111-1122
1 - 10 of 13
Show