Morpholino
MO1-fgf3
- ID
- ZDB-MRPHLNO-041109-4
- Name
- MO1-fgf3
- Previous Names
-
- fgf3-MO #1
- fgf3A-MO
- Target
- Sequence
-
5' - CATTGTGGCATGGCGGGATGTCGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf3
No data available
Phenotype
Phenotype resulting from MO1-fgf3
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-fgf3
1 - 5 of 24 Show all
Citations
- Leino, S.A., Constable, S.C.J., Streit, A., Wilkinson, D.G. (2023) Zbtb16 mediates a switch between Fgf signalling regimes in the developing hindbrain. Development (Cambridge, England). 150(18):
- Osborn, D.P.S., Li, K., Cutty, S.J., Nelson, A.C., Wardle, F.C., Hinits, Y., Hughes, S.M. (2020) Fgf-driven Tbx protein activities directly induce myf5 and myod to initiate zebrafish myogenesis. Development (Cambridge, England). 147(8):
- Goldshmit, Y., Tang, J.K.K.Y., Siegel, A.L., Nguyen, P.D., Kaslin, J., Currie, P.D., Jusuf, P.R. (2018) Different Fgfs have distinct roles in regulating neurogenesis after spinal cord injury in zebrafish. Neural Development. 13:24
- van Boxtel, A.L., Chesebro, J.E., Heliot, C., Ramel, M.C., Stone, R.K., Hill, C.S. (2015) A Temporal Window for Signal Activation Dictates the Dimensions of a Nodal Signaling Domain. Developmental Cell. 35:175-185
- Miyake, A., Chitose, T., Kamei, E., Murakami, A., Nakayama, Y., Konishi, M., Itoh, N. (2014) Fgf16 Is Required for Specification of GABAergic Neurons and Oligodendrocytes in the Zebrafish Forebrain. PLoS One. 9:e110836
- Kuo, C.L., Lam, C.M., Hewitt, J.E., and Scotting, P.J. (2013) Formation of the Embryonic Organizer Is Restricted by the Competitive Influences of Fgf Signaling and the SoxB1 Transcription Factors. PLoS One. 8(2):e57698
- Lin, C.Y., Lee, H.C., Chen, H.C., Hsieh, C.C., and Tsai, H.J. (2013) Normal Function of Myf5 During Gastrulation Is Required for Pharyngeal Arch Cartilage Development in Zebrafish Embryos. Zebrafish. 10(4):486-99
- McCarroll, M.N., and Nechiporuk, A.V. (2013) Fgf3 and Fgf10a work in concert to promote maturation of the epibranchial placodes in zebrafish. PLoS One. 8(12):e85087
- Miyake, A., and Itoh, N. (2013) Fgf22 regulated by Fgf3/Fgf8 signaling is required for zebrafish midbrain development. Biology Open. 2(5):515-524
- Simões, F.C., Peterkin, T., and Patient, R. (2011) Fgf differentially controls cross-antagonism between cardiac and haemangioblast regulators. Development (Cambridge, England). 138(15):3235-3245
1 - 10 of 29
Show