CRISPR

CRISPR1-ace

ID

ZDB-CRISPR-250521-1

Name

CRISPR1-ace

Previous Names

None

Target

ace (1)

Sequence

5' - TGGCTTCCATGAGGCCATCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ouc1004	ace

Expression

Gene expression in Wild Types + CRISPR1-ace

No data available

Phenotype

Phenotype resulting from CRISPR1-ace

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ace

Phenotype	Fish	Conditions	Figures
whole organism mmp9 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 , Figure 8 from Wei et al., 2024
intestine goblet cell increased area, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 from Wei et al., 2024
whole organism mpx expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024
whole organism mmp9 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024
intestine lumen decreased diameter, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 7 from Wei et al., 2024
whole organism cxcl8b.1 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 , Figure 8 from Wei et al., 2024
whole organism mmp30 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 from Wei et al., 2024
whole organism mpx expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 , Figure 8 from Wei et al., 2024
whole organism ace expression decreased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 4 from Wei et al., 2024
whole organism il1b expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 , Figure 8 from Wei et al., 2024
intestine mucus layer increased distribution, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 from Wei et al., 2024
whole organism cxcl8b.1 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024
intestinal epithelium disorganized, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 7 from Wei et al., 2024
whole organism lect2.1 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024
whole organism lect2.1 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 , Figure 8 from Wei et al., 2024
whole organism mmp13a.2 expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 from Wei et al., 2024
intestine decreased diameter, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 7 from Wei et al., 2024
intestinal mucosa increased thickness, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 7 from Wei et al., 2024
whole organism mmp14b expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	standard conditions	Figure 6 from Wei et al., 2024
whole organism viability, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 7 from Wei et al., 2024
intestine mucus layer increased distribution, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024
whole organism il1b expression increased amount, abnormal	ace^{ouc1004/ouc1004} (AB)	chemical treatment by environment: dextran sulfate sodium	Figure 8 from Wei et al., 2024

Citations