CRISPR

CRISPR4-adgrl3.1

ID
ZDB-CRISPR-240703-2
Name
CRISPR4-adgrl3.1
Previous Names
None
Target
Sequence
5' - GCAAGAAGTGTGGGTGCGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3892 adgrl3.1
Expression
Gene expression in Wild Types + CRISPR4-adgrl3.1
No data available
Phenotype
Phenotype resulting from CRISPR4-adgrl3.1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-adgrl3.1
Phenotype Fish Conditions Figures
habituation process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Fig. 2 with image from Fontana et al., 2023
locomotory exploration behavior process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 1 with image from Fontana et al., 2023
locomotory exploration behavior process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Fig. 1 with image from Fontana et al., 2023
habituation decreased process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 2 with image from Fontana et al., 2023
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: aceclofenac Fig. 3 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: amlodipine Fig. 3 with image from Sveinsdóttir et al., 2022
cognition process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 3 from Fontana et al., 2024
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: doxazosin Fig. 3 with image from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 2 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: Moxonidine Fig. 3 with image from Sveinsdóttir et al., 2022
social behavior process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 4 from Fontana et al., 2024
social behavior process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 4 from Fontana et al., 2024
locomotory behavior increased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) lighting conditions Fig. 1 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: atomoxetine Fig. 2 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: clonidine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: Moxonidine Fig. 3 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: amlodipine Fig. 3 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: clonidine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: Guanfacine Fig. 2 with image from Sveinsdóttir et al., 2022
cognition process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 3 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: Guanfacine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: aceclofenac Fig. 3 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: doxazosin Fig. 3 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: atomoxetine Fig. 2 with image from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 2 from Fontana et al., 2024
Citations