CRISPR

CRISPR3-adgrl3.1

ID

ZDB-CRISPR-240703-1

Name

CRISPR3-adgrl3.1

Previous Names

None

Target

adgrl3.1 (1)

Sequence

5' - GAGTCCTCCAGTCTGATAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3892	adgrl3.1

Expression

Gene expression in Wild Types + CRISPR3-adgrl3.1

No data available

Phenotype

Phenotype resulting from CRISPR3-adgrl3.1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-adgrl3.1

Phenotype	Fish	Conditions	Figures
habituation process quality, ameliorated	adgrl3.1^{zf3892/zf3892}	chemical treatment by environment: atomoxetine	Fig. 2 from Fontana et al., 2023
locomotory exploration behavior process quality, abnormal	adgrl3.1^{zf3892/zf3892}	control	Fig. 1 from Fontana et al., 2023
locomotory exploration behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892}	chemical treatment by environment: atomoxetine	Fig. 1 from Fontana et al., 2023
habituation decreased process quality, abnormal	adgrl3.1^{zf3892/zf3892}	control	Fig. 2 from Fontana et al., 2023
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: aceclofenac	Fig. 3 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: amlodipine	Fig. 3 from Sveinsdóttir et al., 2022
cognition process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	undercrowding	Fig. 3 from Fontana et al., 2024
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: doxazosin	Fig. 3 from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	control	Fig. 2 from Fontana et al., 2024
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: Moxonidine	Fig. 3 from Sveinsdóttir et al., 2022
social behavior process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	undercrowding	Fig. 4 from Fontana et al., 2024
social behavior process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	control	Fig. 4 from Fontana et al., 2024
locomotory behavior increased process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions	Fig. 1 from Sveinsdóttir et al., 2022
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: atomoxetine	Fig. 2 from Sveinsdóttir et al., 2022
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: clonidine	Fig. 2 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: Moxonidine	Fig. 3 from Sveinsdóttir et al., 2022
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: amlodipine	Fig. 3 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: clonidine	Fig. 2 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: Guanfacine	Fig. 2 from Sveinsdóttir et al., 2022
cognition process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	control	Fig. 3 from Fontana et al., 2024
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: Guanfacine	Fig. 2 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: aceclofenac	Fig. 3 from Sveinsdóttir et al., 2022
sleep process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	chemical treatment by environment: doxazosin	Fig. 3 from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated	adgrl3.1^{zf3892/zf3892} (AB)	lighting conditions, chemical treatment by environment: atomoxetine	Fig. 2 from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal	adgrl3.1^{zf3892/zf3892} (AB)	undercrowding	Fig. 2 from Fontana et al., 2024

Citations