CRISPR

CRISPR1-cfdp1

ID
ZDB-CRISPR-230727-1
Name
CRISPR1-cfdp1
Previous Names
None
Target
Sequence
5' - GGGAAGGGGAGGATCACGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nub36 cfdp1
Expression
Gene expression in Wild Types + CRISPR1-cfdp1
No data available
Phenotype
Phenotype resulting from CRISPR1-cfdp1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cfdp1
Phenotype Fish Conditions Figures
retinal inner nuclear layer vsx2 expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
cerebellum regulation of mitotic metaphase/anaphase transition decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 6Fig. 7 from Itoh et al., 2021
retinal neural layer regulation of mitotic metaphase/anaphase transition decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
retinal ganglion cell layer atoh7 expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
cerebellum apoptotic process increased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum Ab36-h3 labeling increased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 6 from Itoh et al., 2021
retinal inner nuclear layer vsx2 expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
retinal ganglion cell layer atoh7 expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
retinal photoreceptor layer crx expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
cerebellum has fewer parts of type cerebellar granule cell, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 5 from Itoh et al., 2021
retinal neural layer neurod1 expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
retinal photoreceptor layer crx expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
cerebellum cerebellar granule cell differentiation decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 5 from Itoh et al., 2021
whole organism cfdp1 expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 1 from Itoh et al., 2021
optic tectum apoptotic process increased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 5 from Itoh et al., 2021
retinal inner nuclear layer vsx1 expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
optic tectum regulation of mitotic metaphase/anaphase transition decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 4 from Itoh et al., 2021
head cfdp1 expression decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 1 from Itoh et al., 2021
cerebellum ab5-casp3 labeling increased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 5 from Itoh et al., 2021
retinal neural layer neural retina development decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
cerebellar granule cell axon ab1-slc17a7 labeling decreased amount, abnormal cfdp1nub36/nub36 standard conditions Fig. 1 from Itoh et al., 2021
cerebellum regulation of cerebellar granule cell precursor proliferation decreased process quality, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 6 from Itoh et al., 2021
cerebellum neurod1 expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 4Fig. 5Fig. 6 from Itoh et al., 2021
optic tectum ab5-casp3 labeling increased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 5 from Itoh et al., 2021
retinal neural layer Ab36-h3 labeling increased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
retinal inner nuclear layer vsx1 expression decreased distribution, abnormal cfdp1nub36/nub36 standard conditions Fig. 8 from Itoh et al., 2021
head cfdp1 expression decreased amount, abnormal cfdp1nub36/+ standard conditions Fig. 1 from Itoh et al., 2021
retina regulation of mitotic cell cycle phase transition decreased process quality, abnormal cfdp1nub36/nub36; nk73aGt; nkUAS:Gtuba2Tg standard conditions Fig. 9 from Itoh et al., 2021
cerebellar granule cell axon ab1-slc17a7 labeling decreased amount, abnormal cfdp1rk17/+; cfdp1nub36/+ standard conditions Fig. 1 from Itoh et al., 2021
cerebellum ab5-casp3 labeling spatial pattern, ameliorated cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum cerebellar granule cell differentiation decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum neurod1 expression decreased distribution, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5Fig. 6 from Itoh et al., 2021
cerebellum has fewer parts of type cerebellar granule cell, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum regulation of mitotic metaphase/anaphase transition decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
cerebellum apoptotic process process quality, ameliorated cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum Ab36-h3 labeling increased distribution, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
cerebellum regulation of cerebellar granule cell precursor proliferation decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
Citations