Morpholino Name: | MO2-aplnrb | ||||||
---|---|---|---|---|---|---|---|
Target: | aplnrb (1) | ||||||
Previous Name: | MO2-agtrl1b | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - CAGAGAAGTTGTTTGTCATGTGTCT - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | The morpholino has a 3 bp mismatch at the 3' end to agtrl1b sequences currently in the sequence databanks. The authors have verified the sequence of the morpholino. |