Morpholino Name: | MO2-tal1 | ||||||
---|---|---|---|---|---|---|---|
Target: | tal1 (1) | ||||||
Previous Names: | SCL E2/I, tal1 MO E2/I | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - AATGCTCTTACCATCGTTGATTTC - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | Originally reported to target the exon/intron boundary of exon 2. Current analysis suggests this boundary to be exon/intron 3. This morpholino is one bp shorter than MO4-tal1, which is reported to hybridize to exon/intron 3. |