ZFIN ID: ZDB-GENE-980526-290

Mapping Details

Gene Name: homeobox B1b
Symbol: hoxb1b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 12 27,141,140 - 27,142,834 GRCz11
Ensembl 12 27,141,140 - 27,142,834 GRCz11
Vega 12 27,049,780 - 27,051,474 GRCv10
NCBI Map Viewer 12 27,141,140 - 27,142,834 GRCz11
UCSC 12 - GRCz11
Mapped Clones containing hoxb1b
BUSM1-227H09 Chr: 12 Details
DKEY-11C5 Chr: 12 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
b1219 12 27,141,787 GRCz11 Miller et al., 2013
um195 12 27,141,734 - 27,141,741 GRCz11 Weicksel et al., 2014
um196 12 27,141,736 - 27,141,741 GRCz11 Weicksel et al., 2014
um197 12 27,141,724 - 27,141,740 GRCz11 Weicksel et al., 2014
b1219 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
fh095 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
fh286 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
hoxb1b_unrecovered 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
tud17Gt 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
ua1006 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
um195 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
um196 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11
um197 12 GRCz11
12 GRCz11
12 GRCz11
12 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 226.68 cR hoxa1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
12 3414.0 cR hoxb1b Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxb8b GENE 12 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb6b GENE 12 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb5b GENE 12 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
mir10a MIRNAG 12 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.
hoxb5b GENE 12 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.

OTHER MAPPING INFORMATION
Chr 12 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b,  ...
Chr 12 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 693 AluI 36.0
Forward Primer GACAGTGACAGCGACTCCAA
Reverse Primer TAATTGACCGGACGACAACA
Genomic Feature tud17Gt is an allele of hoxb1b