Morpholino

MO2-zfhx4

ID
ZDB-MRPHLNO-250630-3
Name
MO2-zfhx4
Previous Names
None
Target
Sequence
5' - AAGGGAAAACTACTCACCATGACCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zfhx4
No data available
Phenotype
Phenotype resulting from MO2-zfhx4
Phenotype Fish Figures
cranial neural crest cell ab6-gfp labeling spatial pattern, abnormal zf4119Tg + MO2-zfhx4 (RW) FIGURE 6 with image from Liu et al., 2024
cranial neural crest cell neural crest cell migration decreased process quality, abnormal zf4119Tg + MO2-zfhx4 (RW) FIGURE 6 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased length, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased size, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage morphology, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased length, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased size, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage morphology, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO2-zfhx4 FIGURE 4 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest ab6-gfp labeling decreased distribution, abnormal zf4119Tg + MO2-zfhx4 (RW) FIGURE 6 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest Ab2-zfhx4 labeling decreased distribution, abnormal zf4119Tg + MO2-zfhx4 (RW) FIGURE 6 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest ab6-gfp labeling spatial pattern, abnormal zf4119Tg + MO2-zfhx4 (RW) FIGURE 6 with image from Liu et al., 2024
Phenotype of all Fish created by or utilizing MO2-zfhx4
Phenotype Fish Conditions Figures
ethmoid cartilage morphology, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased length, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased size, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased size, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage morphology, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased length, abnormal RW + MO2-zfhx4 control FIGURE 4 with image from Liu et al., 2024
cranial neural crest cell ab6-gfp labeling spatial pattern, abnormal zf4119Tg + MO2-zfhx4 (RW) control FIGURE 6 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest ab6-gfp labeling spatial pattern, abnormal zf4119Tg + MO2-zfhx4 (RW) control FIGURE 6 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest ab6-gfp labeling decreased distribution, abnormal zf4119Tg + MO2-zfhx4 (RW) control FIGURE 6 with image from Liu et al., 2024
cranial neural crest cell neural crest cell migration decreased process quality, abnormal zf4119Tg + MO2-zfhx4 (RW) control FIGURE 6 with image from Liu et al., 2024
pharyngeal arch 1 cranial neural crest Ab2-zfhx4 labeling decreased distribution, abnormal zf4119Tg + MO2-zfhx4 (RW) control FIGURE 6 with image from Liu et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.