Morpholino

MO1-eif2ak4

ID

ZDB-MRPHLNO-240125-1

Name

MO1-eif2ak4

Previous Names

None

Target

eif2ak4 (1)

Sequence

5' - TCATCCTTCATTCATCTTTCTTCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-eif2ak4

No data available

Phenotype

Phenotype resulting from MO1-eif2ak4

No data available

Phenotype of all Fish created by or utilizing MO1-eif2ak4

Phenotype	Fish	Conditions	Figures
whole organism atf3 expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
PERK-mediated unfolded protein response increased occurrence, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism cdkn1a expression increased amount, abnormal	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism trib3 expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism eif2s1b expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 3 from Zhang et al., 2021
whole organism stc2a expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism Ab7-eif2a labeling amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 3 from Zhang et al., 2021
whole organism gadd45aa expression increased amount, abnormal	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism asns expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism igfbp1a expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism atf5a expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
trunk vasculature branching involved in blood vessel morphogenesis decreased process quality, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism chac1 expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
GCN2-mediated signaling increased occurrence, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism cbsb expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism cth expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism psat1 expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism vegfaa expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021
whole organism sesn2 expression amount, ameliorated	tars1^rj36/rj36 + MO1-eif2ak4	standard conditions	Fig. 2 from Zhang et al., 2021

Citations