Morpholino

MO1-eif2ak4

ID
ZDB-MRPHLNO-240125-1
Name
MO1-eif2ak4
Previous Names
None
Target
Sequence
5' - TCATCCTTCATTCATCTTTCTTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eif2ak4
No data available
Phenotype
Phenotype resulting from MO1-eif2ak4
No data available
Phenotype of all Fish created by or utilizing MO1-eif2ak4
Phenotype Fish Conditions Figures
whole organism atf3 expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
PERK-mediated unfolded protein response increased occurrence, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism cdkn1a expression increased amount, abnormal tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism trib3 expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism eif2s1b expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 3 with image from Zhang et al., 2021
whole organism stc2a expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism Ab7-eif2a labeling amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 3 with image from Zhang et al., 2021
whole organism gadd45aa expression increased amount, abnormal tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism asns expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism igfbp1a expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism atf5a expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
trunk vasculature branching involved in blood vessel morphogenesis decreased process quality, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 4 with image from Zhang et al., 2021
whole organism chac1 expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
GCN2-mediated signaling increased occurrence, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism cbsb expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism cth expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism psat1 expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism vegfaa expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
whole organism sesn2 expression amount, ameliorated tars1rj36/rj36 + MO1-eif2ak4 standard conditions Fig. 2 with image from Zhang et al., 2021
Citations