Morpholino
MO1-hhatla
- ID
- ZDB-MRPHLNO-220301-1
- Name
- MO1-hhatla
- Previous Names
- None
- Target
- Sequence
-
5' - GGCCTCCAGTGGTACACTTTATTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hhatla
No data available
Phenotype
Phenotype resulting from MO1-hhatla
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-hhatla
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
cardiac ventricle myl7 expression increased distribution, abnormal | WT + MO1-hhatla | control |
Fig. 3
from Shi et al., 2020 |
myotome disorganized, abnormal | WT + MO1-hhatla | control |
Fig. 3
from Shi et al., 2020 |
heart nppb expression increased amount, abnormal | WT + MO1-hhatla | control |
Fig. 4
from Shi et al., 2020 |
cardiac ventricle myh7 expression increased distribution, abnormal | WT + MO1-hhatla | control |
Fig. 3
from Shi et al., 2020 |
heart nppb expression increased distribution, abnormal | WT + MO1-hhatla | control |
Fig. 4
from Shi et al., 2020 |
1 - 5 of 27 Show all
Citations