Morpholino

MO1-ndufa7

ID
ZDB-MRPHLNO-211022-4
Name
MO1-ndufa7
Previous Names
None
Target
Sequence
5' - GGAGATCTTGCTGTTAAGAAACGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ndufa7
No data available
Phenotype
Phenotype resulting from MO1-ndufa7
Phenotype Fish Figures
atrium nppa expression increased amount, abnormal WT + MO1-ndufa7 Figure 4 with image from Shi et al., 2020
bulbus arteriosus elongated, abnormal WT + MO1-ndufa7 Figure 3 with image from Shi et al., 2020
cardiac ventricle decreased functionality, abnormal twu34Tg + MO1-ndufa7 Figure 2 with image from Shi et al., 2020
cardiac ventricle deformed, abnormal twu34Tg + MO1-ndufa7 Figure 2 with image from Shi et al., 2020
cardiac ventricle nppa expression increased amount, abnormal twu34Tg + MO1-ndufa7 Figure 4 with image from Shi et al., 2020
cardiac ventricle nppb expression increased amount, abnormal WT + MO1-ndufa7 Figure 4 with image from Shi et al., 2020
cardiac ventricle increased size, abnormal WT + MO1-ndufa7 Figure 3 with image from Shi et al., 2020
head decreased size, abnormal twu34Tg + MO1-ndufa7 Figure 2 with imageFigure 3 with image from Shi et al., 2020
heart atp2a2a expression decreased amount, abnormal twu34Tg + MO1-ndufa7 Figure 5 with image from Shi et al., 2020
heart ppp3r1a expression increased amount, abnormal twu34Tg + MO1-ndufa7 Figure 5 with image from Shi et al., 2020
heart myh7 expression increased amount, abnormal twu34Tg + MO1-ndufa7 Figure 3 with image from Shi et al., 2020
heart nppb expression increased amount, abnormal twu34Tg + MO1-ndufa7 Figure 4 with image from Shi et al., 2020
heart myl7 expression increased amount, abnormal twu34Tg + MO1-ndufa7 Figure 3 with image from Shi et al., 2020
heart reactive oxygen species increased amount, abnormal WT + MO1-ndufa7 Figure 5 with image from Shi et al., 2020
heart contraction decreased rate, abnormal twu34Tg + MO1-ndufa7 Figure 2 with image from Shi et al., 2020
post-vent region curved, abnormal twu34Tg + MO1-ndufa7 Figure 2 with image from Shi et al., 2020
post-vent region decreased length, abnormal twu34Tg + MO1-ndufa7 Figure 2 with image from Shi et al., 2020
somite disorganized, abnormal WT + MO1-ndufa7 Figure 3 with image from Shi et al., 2020
whole organism Luciferase expression increased amount, abnormal zf3504Tg + MO1-ndufa7 Figure 4 with image from Shi et al., 2020
Phenotype of all Fish created by or utilizing MO1-ndufa7
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
cardiac ventricle increased size, abnormal WT + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
cardiac ventricle size, ameliorated WT + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
atrium nppa expression increased amount, abnormal WT + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
cardiac ventricle nppb expression increased amount, abnormal WT + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
heart reactive oxygen species increased amount, abnormal WT + MO1-ndufa7 standard conditions Figure 5 with image from Shi et al., 2020
cardiac ventricle nppa expression increased amount, abnormal WT + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
somite disorganized, abnormal WT + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
bulbus arteriosus elongated, abnormal WT + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
cardiac ventricle deformed, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
post-vent region decreased length, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
heart ppp3r1a expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 5 with image from Shi et al., 2020
heart nppb expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
heart nppb expression amount, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
post-vent region curved, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
post-vent region straight, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
heart myh7 expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
atrium nppa expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
head decreased size, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
heart nppa expression amount, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
heart contraction rate, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
heart contraction decreased rate, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
heart atp2a2a expression decreased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 5 with image from Shi et al., 2020
heart myl7 expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 3 with image from Shi et al., 2020
cardiac ventricle nppa expression increased amount, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
cardiac ventricle morphology, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
cardiac ventricle decreased functionality, abnormal twu34Tg + MO1-ndufa7 standard conditions Figure 2 with image from Shi et al., 2020
cardiac ventricle functionality, ameliorated twu34Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
whole organism Luciferase expression increased amount, abnormal zf3504Tg + MO1-ndufa7 standard conditions Figure 4 with image from Shi et al., 2020
whole organism Luciferase expression amount, ameliorated zf3504Tg + MO1-ndufa7 chemical treatment by environment: tacrolimus (anhydrous) Figure 5 with image from Shi et al., 2020
Citations