Morpholino

MO1-marchf5

ID
ZDB-MRPHLNO-200812-3
Name
MO1-marchf5
Previous Names
  • MO1-march5
Target
Sequence
5' - TTTGTTTCTTTCACTTACCTGTCCACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-marchf5
No data available
Phenotype
Phenotype resulting from MO1-marchf5
Phenotype Fish Figures
axial chorda mesoderm tbxta expression spatial pattern, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
convergent extension process quality, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
diencephalon ventral region emx3 expression absent, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
eye decreased diameter, abnormal WT + MO1-marchf5 Fig. 2 from Jung et al., 2020
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
forerunner cell group sox17 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 4 from Jung et al., 2020
midbrain hindbrain boundary decreased distance rhombomere 3, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
optic primordium rx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
telencephalon emx3 expression decreased amount, abnormal WT + MO1-marchf5 Fig. 5 from Jung et al., 2020
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-marchf5 Fig. 2 from Jung et al., 2020
whole organism dorsal region gsc expression decreased amount, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased amount, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-marchf5 Fig. 3 from Jung et al., 2020
Phenotype of all Fish created by or utilizing MO1-marchf5
Phenotype Fish Conditions Figures
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
whole organism ventral region bmp2b expression increased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
axial chorda mesoderm tbxta expression spatial pattern, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
eye decreased diameter, abnormal WT + MO1-marchf5 standard conditions Fig. 2 from Jung et al., 2020
whole organism dorsal region gsc expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
optic primordium rx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-marchf5 standard conditions Fig. 2 from Jung et al., 2020
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
convergent extension process quality, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
diencephalon ventral region emx3 expression absent, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
forerunner cell group sox17 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 4 from Jung et al., 2020
telencephalon emx3 expression decreased amount, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-marchf5 standard conditions Fig. 3 from Jung et al., 2020
midbrain hindbrain boundary decreased distance rhombomere 3, abnormal WT + MO1-marchf5 standard conditions Fig. 5 from Jung et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.