Morpholino
MO1-linc-tr
- ID
- ZDB-MRPHLNO-180305-2
- Name
- MO1-linc-tr
- Previous Names
-
- TRMO1 (1)
- Target
- Sequence
-
5' - AAGAAGCGTTAGGGTTAGAGAAAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-linc-tr
No data available
Phenotype
Phenotype resulting from MO1-linc-tr
Phenotype | Fish | Figures |
---|---|---|
telomerase activity decreased process quality, abnormal | WT + MO1-linc-tr |
Fig. 1
from Alcaraz-Pérez et al., 2014 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-linc-tr
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
telomerase activity decreased process quality, abnormal | WT + MO1-linc-tr | standard conditions |
Fig. 1
from Alcaraz-Pérez et al., 2014 |
1 - 1 of 1
Citations
- García-Castillo, J., Alcaraz-Pérez, F., Martínez-Balsalobre, E., García-Moreno, D., Rossmann, M.P., Fernández-Lajarín, M., Bernabé-García, M., Pérez-Oliva, A.B., Rodríguez-Cortez, V.C., Bueno, C., Adatto, I., Agarwal, S., Menéndez, P., Zon, L.I., Mulero, V., Cayuela, M.L. (2021) Telomerase RNA recruits RNA polymerase II to target gene promoters to enhance myelopoiesis. Proceedings of the National Academy of Sciences of the United States of America. 118(32):
- Alcaraz-Pérez, F., García-Castillo, J., García-Moreno, D., López-Muñoz, A., Anchelin, M., Angosto, D., Zon, L.I., Mulero, V., and Cayuela, M.L. (2014) A non-canonical function of telomerase RNA in the regulation of developmental myelopoiesis in zebrafish. Nature communications. 5:3228
1 - 2 of 2
Show