Morpholino
MO2-rigi
- ID
- ZDB-MRPHLNO-180129-2
- Name
- MO2-rigi
- Previous Names
-
- MO2-ddx58
- Target
- Sequence
-
5' - GATTCTCCTTCTCCAGCTCGTACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rigi
No data available
Phenotype
Phenotype resulting from MO2-rigi
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO2-rigi
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
posterior lateral mesoderm tal1 expression decreased distribution, abnormal | AB + MO2-rigi | control |
Fig. 2 ![]() ![]() ![]() ![]() |
whole organism tal1 expression decreased amount, abnormal | AB + MO2-rigi | control |
Fig. 2 ![]() |
whole organism ifnphi2 expression decreased amount, abnormal | AB + MO2-rigi | control |
Fig. 7 ![]() |
nucleate erythrocyte decreased distribution, abnormal | AB + MO2-rigi | control |
Fig. 2 ![]() |
macrophage lcp1 expression decreased distribution, abnormal | AB + MO2-rigi | control |
Fig. 1 ![]() ![]() |
1 - 5 of 22 Show all
Citations
- Wang, Y.Y., Nie, L., Xu, X.X., Shao, T., Fan, D.D., Lin, A.F., Xiang, L.X., Shao, J.Z. (2022) Essential Role of RIG-I in Hematopoietic Precursor Emergence in Primitive Hematopoiesis during Zebrafish Development. ImmunoHorizons. 6:283-298
- Nie, L., Xu, X.X., Xiang, L.X., Shao, J.Z., Chen, J. (2017) Mutual Regulation of NOD2 and RIG-I in Zebrafish Provides Insights into the Coordination between Innate Antibacterial and Antiviral Signaling Pathways. International Journal of Molecular Sciences. 18(6):1147
1 - 2 of 2
Show