Morpholino
MO2-tbc1d23
- ID
- ZDB-MRPHLNO-171027-3
- Name
- MO2-tbc1d23
- Previous Names
-
- intron 4 to exon 5 (1)
- Target
- Sequence
-
5' - GCAGTCTCTGCAAAAGGCAATATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbc1d23
No data available
Phenotype
Phenotype resulting from MO2-tbc1d23
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-tbc1d23
1 - 5 of 6 Show all
Citations
- Huang, W., Liu, Z., Yang, F., Zhou, H., Yong, X., Yang, X., Zhou, Y., Xue, L., Zhang, Y., Liu, D., Meng, W., Zhang, W., Zhang, X., Shen, X., Sun, Q., Li, L., Ma, C., Wei, Y., Billadeau, D.D., Mo, X., Jia, D. (2019) Structural and functional studies of TBC1D23 C-terminal domain provide a link between endosomal trafficking and PCH. Proceedings of the National Academy of Sciences of the United States of America. 116(45):22598-22608
- Marin-Valencia, I., Gerondopoulos, A., Zaki, M.S., Ben-Omran, T., Almureikhi, M., Demir, E., Guemez-Gamboa, A., Gregor, A., Issa, M.Y., Appelhof, B., Roosing, S., Musaev, D., Rosti, B., Wirth, S., Stanley, V., Baas, F., Barr, F.A., Gleeson, J.G. (2017) Homozygous Mutations in TBC1D23 Lead to a Non-degenerative Form of Pontocerebellar Hypoplasia. American journal of human genetics. 101(3):441-450
1 - 2 of 2
Show