Morpholino

MO1-ninl

ID
ZDB-MRPHLNO-170227-3
Name
MO1-ninl
Previous Names
None
Target
Sequence
5' - CATCCTCGTCCATCCCACCACATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ninl
No data available
Phenotype
Phenotype resulting from MO1-ninl
Phenotype Fish Figures
eye decreased size, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vesicle, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vacuole, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO1-ninl Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell Ab1-rab8a labeling decreased distribution, abnormal WT + MO1-ninl Fig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO1-ninl Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell axoneme decreased length, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
Fig. S9 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell intracellular protein localization disrupted, abnormal WT + MO1-ninl Fig. 3 with imageFig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl Fig. 3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
Fig. 3 with imageFig. 4 with imageFig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment structure, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl Fig. S4 with image from Bachmann-Gagescu et al., 2015
Fig. 3 with image from Dona et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal WT + MO1-ninl Fig. 3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal li1Tg + MO1-ninl Fig. S3 with image from Bachmann-Gagescu et al., 2015
ventricular system dilated, abnormal WT + MO1-ninl Fig. S3 with image from Bachmann-Gagescu et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-ninl Fig. S3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
Phenotype of all Fish created by or utilizing MO1-ninl
Phenotype Fish Conditions Figures
melanosome transport delayed, abnormal TL + MO1-ninl chemical treatment: (R)-adrenaline Fig. 7 with image from Dona et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl control Fig. 3 with imageFig. 4 with imageFig. 5 with image from Dona et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO1-ninl control Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal TL + MO1-ninl control Fig. S9 with image from Dona et al., 2015
eye decreased size, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO1-ninl control Fig. 6 with image from Dona et al., 2015
ventricular system dilated, abnormal WT + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-ninl standard conditions Fig. 3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal WT + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
pericardium edematous, abnormal WT + MO1-ninl standard conditions Fig. S4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment structure, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell axoneme decreased length, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vesicle, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal WT + MO1-ninl standard conditions Fig. 3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-ninl standard conditions Fig. S3 with imageFig. S4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell intracellular protein localization disrupted, abnormal WT + MO1-ninl control Fig. 3 with imageFig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell Ab1-rab8a labeling decreased distribution, abnormal WT + MO1-ninl control Fig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vacuole, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal WT + MO1-ninl control Fig. 3 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal li1Tg + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell intracellular protein localization disrupted, abnormal cc2d2aw38/w38 + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell ab5-rho labeling mislocalised, abnormal cc2d2aw38/w38 + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
whole organism anterior-posterior axis decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
post-vent region increased curvature, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
swimming disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with imageFig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
pronephros cystic, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
pronephric glomerulus dilated, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
pronephric duct dilated, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
Citations