Morpholino
MO2-ins
- ID
- ZDB-MRPHLNO-160331-1
- Name
- MO2-ins
- Previous Names
- None
- Target
- Sequence
-
5' - CCTCTACTTGACTTTCTTACCCAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ins
No data available
Phenotype
Phenotype resulting from MO2-ins
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-ins
1 - 5 of 17 Show all
Citations
- Mullapudi, S.T., Helker, C.S., Boezio, G.L., Maischein, H.M., Sokol, A.M., Guenther, S., Matsuda, H., Kubicek, S., Graumann, J., Yang, Y.H.C., Stainier, D.Y. (2018) Screening for insulin-independent pathways that modulate glucose homeostasis identifies androgen receptor antagonists. eLIFE. 7:
- Zhang, Y.M., Zimmer, M.A., Guardia, T., Callahan, S.J., Mondal, C., Di Martino, J., Takagi, T., Fennell, M., Garippa, R., Campbell, N.R., Bravo-Cordero, J.J., White, R.M. (2018) Distant Insulin Signaling Regulates Vertebrate Pigmentation through the Sheddase Bace2. Developmental Cell. 45(5):580-594.e7
- O'Hare, E.A., Yerges-Armstrong, L.M., Perry, J.A., Shuldiner, A.R., Zaghloul, N.A. (2016) Assignment of Functional Relevance to Genes at Type 2 Diabetes-Associated Loci Through Investigation of β-Cell Mass Deficits. Molecular endocrinology (Baltimore, Md.). 30(4):429-45
- Ye, L., Robertson, M.A., Mastracci, T.L., Anderson, R.M. (2016) An insulin signaling feedback loop regulates pancreas progenitor cell differentiation during islet development and regeneration. Developmental Biology. 409(2):354-69
1 - 4 of 4
Show