Morpholino
MO1-ada2b
- ID
- ZDB-MRPHLNO-150813-1
- Name
- MO1-ada2b
- Previous Names
-
- MO1-cecr1b
- cecr1b ATG-MO (1)
- Target
- Sequence
-
5' - GCTTATGCTACTCATTGCTCCCAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ada2b
No data available
Phenotype
Phenotype resulting from MO1-ada2b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-ada2b
1 - 5 of 23 Show all
Citations
- Brix, A., Belleri, L., Pezzotta, A., Pettinato, E., Mazzola, M., Zoccolillo, M., Marozzi, A., Monteiro, R., Del Bene, F., Mortellaro, A., Pistocchi, A. (2024) ADA2 regulates inflammation and hematopoietic stem cell emergence via the A2bR pathway in zebrafish. Communications biology. 7:615615
- Gessler, S., Guthmann, C., Schuler, V., Lilienkamp, M., Walz, G., Yakulov, T.A. (2022) Control of Directed Cell Migration after Tubular Cell Injury by Nucleotide Signaling. International Journal of Molecular Sciences. 23(14):
- Kasher, P.R., Jenkinson, E.M., Briolat, V., Gent, D., Morrissey, C., Zeef, L.A., Rice, G.I., Levraud, J.P., Crow, Y.J. (2015) Characterization of samhd1 Morphant Zebrafish Recapitulates Features of the Human Type I Interferonopathy Aicardi-Goutières Syndrome. Journal of immunology (Baltimore, Md. : 1950). 194(6):2819-25
- Zhou, Q., Yang, D., Ombrello, A.K., Zavialov, A.V., Toro, C., Zavialov, A.V., Stone, D.L., Chae, J.J., Rosenzweig, S.D., Bishop, K., Barron, K.S., Kuehn, H.S., Hoffmann, P., Negro, A., Tsai, W.L., Cowen, E.W., Pei, W., Milner, J.D., Silvin, C., Heller, T., Chin, D.T., Patronas, N.J., Barber, J.S., Lee, C.C., Wood, G.M., Ling, A., Kelly, S.J., Kleiner, D.E., Mullikin, J.C., Ganson, N.J., Kong, H.H., Hambleton, S., Candotti, F., Quezado, M.M., Calvo, K.R., Alao, H., Barham, B.K., Jones, A., Meschia, J.F., Worrall, B.B., Kasner, S.E., Rich, S.S., Goldbach-Mansky, R., Abinun, M., Chalom, E., Gotte, A.C., Punaro, M., Pascual, V., Verbsky, J.W., Torgerson, T.R., Singer, N.G., Gershon, T.R., Ozen, S., Karadag, O., Fleisher, T.A., Remmers, E.F., Burgess, S.M., Moir, S.L., Gadina, M., Sood, R., Hershfield, M.S., Boehm, M., Kastner, D.L., Aksentijevich, I. (2014) Early-onset stroke and vasculopathy associated with mutations in ADA2. The New England Journal of Medicine. 370(10):911-920
1 - 4 of 4
Show