Morpholino
MO2-pycard
- ID
- ZDB-MRPHLNO-150327-2
- Name
- MO2-pycard
- Previous Names
- None
- Target
- Sequence
-
5' - CAATTGCACTTACATTGCCCTGTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pycard
No data available
Phenotype
Phenotype resulting from MO2-pycard
No data available
Phenotype of all Fish created by or utilizing MO2-pycard
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
hematopoietic multipotent progenitor cell decreased amount, abnormal | s916Tg; zf169Tg + MO2-pycard | standard conditions |
Fig. 2 ![]() |
1 - 1 of 1
Citations
- Frame, J.M., Kubaczka, C., Long, T.L., Esain, V., Soto, R.A., Hachimi, M., Jing, R., Shwartz, A., Goessling, W., Daley, G.Q., North, T.E. (2020) Metabolic Regulation of Inflammasome Activity Controls Embryonic Hematopoietic Stem and Progenitor Cell Production. Developmental Cell. 55(2):133-149.e6
- Huang, C., Niethammer, P. (2018) Tissue Damage Signaling Is a Prerequisite for Protective Neutrophil Recruitment to Microbial Infection in Zebrafish. Immunity. 48:1006-1013.e6
- Progatzky, F., Sangha, N.J., Yoshida, N., McBrien, M., Cheung, J., Shia, A., Scott, J., Marchesi, J.R., Lamb, J.R., Bugeon, L., Dallman, M.J. (2014) Dietary cholesterol directly induces acute inflammasome-dependent intestinal inflammation. Nature communications. 5:5864
1 - 3 of 3
Show