Morpholino
MO2-smarcd2
- ID
- ZDB-MRPHLNO-141230-12
- Name
- MO2-smarcd2
- Previous Names
- None
- Target
- Sequence
-
5' - CCGAGAAACCCGATCTCGAAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-smarcd2
No data available
Phenotype
Phenotype resulting from MO2-smarcd2
Phenotype | Fish | Figures |
---|---|---|
neutrophil decreased amount, abnormal | nz50Tg + MO2-smarcd2 |
Fig. 4,
Fig. S4
from Witzel et al., 2017 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-smarcd2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
neutrophil decreased amount, abnormal | i114Tg + MO2-smarcd2 | standard conditions |
Fig. S4
from Witzel et al., 2017 |
neutrophil decreased amount, abnormal | nz50Tg + MO2-smarcd2 | standard conditions |
Fig. 4
from Witzel et al., 2017 |
1 - 2 of 2
Citations
- Witzel, M., Petersheim, D., Fan, Y., Bahrami, E., Racek, T., Rohlfs, M., Puchałka, J., Mertes, C., Gagneur, J., Ziegenhain, C., Enard, W., Stray-Pedersen, A., Arkwright, P.D., Abboud, M.R., Pazhakh, V., Lieschke, G.J., Krawitz, P.M., Dahlhoff, M., Schneider, M.R., Wolf, E., Horny, H.P., Schmidt, H., Schäffer, A.A., Klein, C. (2017) Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes. Nature Genetics. 49(5):742-752
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
1 - 2 of 2
Show