Morpholino

MO1-exosc8

ID
ZDB-MRPHLNO-140929-1
Name
MO1-exosc8
Previous Names
None
Target
Sequence
5' - AGATTAACTCTCACCAGAAAGCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-exosc8
No data available
Phenotype
Phenotype resulting from MO1-exosc8
Phenotype of all Fish created by or utilizing MO1-exosc8
Phenotype Fish Conditions Figures
lateral line nerve myelin sheath absent, abnormal WT + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination of lateral line nerve axons disrupted, abnormal WT + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
swimming disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions text only from Boczonadi et al., 2014
post-vent region decreased length, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
pericardium edematous, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
eye decreased size, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
eye shape, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
lateral line nerve myelin sheath absent, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
spinal cord curvature, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination of lateral line nerve axons disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
motor neuron axon decreased thickness, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
motor neuron axon hypoplastic, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
spinal cord structure, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
motor neuron axon decreased length, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
brain development disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
Citations