Morpholino
MO1-cxcr2
- ID
- ZDB-MRPHLNO-140915-1
- Name
- MO1-cxcr2
- Previous Names
- None
- Target
- Sequence
-
5' - ACTCTGTAGTAGCAGTTTCCATGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
ATG morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcr2
No data available
Phenotype
Phenotype resulting from MO1-cxcr2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-cxcr2
1 - 5 of 5
Citations
- Coombs, C., Georgantzoglou, A., Walker, H.A., Patt, J., Merten, N., Poplimont, H., Busch-Nentwich, E.M., Williams, S., Kotsi, C., Kostenis, E., Sarris, M. (2019) Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish. Nature communications. 10:5166
- Gabellini, C., Gómez-Abenza, E., Ibáñez-Molero, S., Tupone, M.G., Pérez-Oliva, A.B., de Oliveira, S., Del Bufalo, D., Mulero, V. (2017) Interleukin 8 mediates bcl-xL-induced enhancement of human melanoma cell dissemination and angiogenesis in a zebrafish xenograft model. International Journal of Cancer. 142(3):584-596
- Powell, D., Tauzin, S., Hind, L.E., Deng, Q., Beebe, D.J., Huttenlocher, A. (2017) Chemokine Signaling and the Regulation of Bidirectional Leukocyte Migration in Interstitial Tissues. Cell Reports. 19:1572-1585
- Tyrkalska, S.D., Candel, S., Angosto, D., Gómez-Abellán, V., Martín-Sánchez, F., García-Moreno, D., Zapata-Pérez, R., Sánchez-Ferrer, Á., Sepulcre, M.P., Pelegrín, P., Mulero, V. (2016) Neutrophils mediate Salmonella Typhimurium clearance through the GBP4 inflammasome-dependent production of prostaglandins. Nature communications. 7:12077
- Freisinger, C.M., Huttenlocher, A. (2014) Live Imaging and Gene Expression Analysis in Zebrafish Identifies a Link between Neutrophils and Epithelial to Mesenchymal Transition. PLoS One. 9:e112183
- Deng, Q., Sarris, M., Bennin, D.A., Green, J.M., Herbomel, P., and Huttenlocher, A. (2013) Localized bacterial infection induces systemic activation of neutrophils through Cxcr2 signaling in zebrafish. Journal of Leukocyte Biology. 93(5):761-9
1 - 6 of 6
Show