Morpholino
MO3-ephb4a
- ID
- ZDB-MRPHLNO-140709-2
- Name
- MO3-ephb4a
- Previous Names
-
- splice (1)
- Target
- Sequence
-
5' - CTGGAAAACACACACGAGAGATAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ephb4a
No data available
Phenotype
Phenotype resulting from MO3-ephb4a
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO3-ephb4a
1 - 5 of 26 Show all
Citations
- Baek, K.I., Chang, S.S., Chang, C.C., Roustaei, M., Ding, Y., Wang, Y., Chen, J., O'Donnell, R., Chen, H., Ashby, J.W., Xu, X., Mack, J.J., Cavallero, S., Roper, M., Hsiai, T.K. (2022) Vascular Injury in the Zebrafish Tail Modulates Blood Flow and Peak Wall Shear Stress to Restore Embryonic Circular Network. Frontiers in cardiovascular medicine. 9:841101
- Vivanti, A., Ozanne, A., Grondin, C., Saliou, G., Quevarec, L., Maurey, H., Aubourg, P., Benachi, A., Gut, M., Gut, I., Martinovic, J., Sénat, M.V., Tawk, M., Melki, J. (2018) Loss of function mutations in EPHB4 are responsible for vein of Galen aneurysmal malformation. Brain : a journal of neurology. 141(4):979-988
- Kawasaki, J., Aegerter, S., Fevurly, R.D., Mammoto, A., Mammoto, T., Sahin, M., Mably, J.D., Fishman, S.J., Chan, J. (2014) RASA1 functions in EPHB4 signaling pathway to suppress endothelial mTORC1 activity. J. Clin. Invest.. 124(6):2774-84
1 - 3 of 3
Show