Morpholino
MO3-nphs2
- ID
- ZDB-MRPHLNO-140522-6
- Name
- MO3-nphs2
- Previous Names
-
- podocinMOex3 (1)
- Target
- Sequence
-
5' - TGCGATTTAAAACGTGTACCAGGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO. The author was contacted and provided the correct morpholino sequence.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nphs2
No data available
Phenotype
Phenotype resulting from MO3-nphs2
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO3-nphs2
1 - 5 of 9 Show all
Citations
- Naylor, R.W., Lemarie, E., Jackson-Crawford, A., Davenport, J.B., Mironov, A., Lowe, M., Lennon, R. (2022) A novel nanoluciferase transgenic reporter measures proteinuria in zebrafish. Kidney International. 102(4):815-827
- Dong, L., Pietsch, S., Tan, Z., Perner, B., Sierig, R., Kruspe, D., Groth, M., Witzgall, R., Gröne, H., Platzer, M., Englert, C. (2015) Integration of Cistromic and Transcriptomic Analyses Identifies Nphs2, Mafb, and Magi2 as Wilms' Tumor 1 Target Genes in Podocyte Differentiation and Maintenance. Journal of the American Society of Nephrology : JASN. 26(9):2118-28
- Fukuyo, Y., Nakamura, T., Bubenshchikova, E., Powell, R., Tsuji, T., Janknecht, R., and Obara, T. (2014) Nephrin and Podocin functions are highly conserved between the zebrafish pronephros and mammalian metanephros. Molecular Medicine Reports. 9(2):457-465
1 - 3 of 3
Show