Morpholino

MO1-dis3l2

ID
ZDB-MRPHLNO-131220-1
Name
MO1-dis3l2
Previous Names
  • Zfdis3l2-ATG MO (1)
Target
Sequence
5' - ATGCCATAATCTCGTCTACAGTTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dis3l2
No data available
Phenotype
Phenotype resulting from MO1-dis3l2
Phenotype Fish Figures
blastomere metaphase chromosome alignment decreased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic nuclear bridge increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic spindle elongated, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic spindle ab3-tuba labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere spindle pole distributed, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere spindle pole Ab8-tubg1 labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
brain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
brain deformed, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
brain apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
cloaca development disrupted, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
cranial cartilage morphology, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
cranial neural crest twist1a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
cranial neural crest foxd3 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye deformed, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
forebrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
forebrain undulate, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
head decreased area, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
hindbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
midbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary absence of anatomical entity, abnormal AB/TU + MO1-dis3l2 Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
midbrain hindbrain boundary fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
neural crest sox10 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
neural tube apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
optic stalk pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
otic vesicle pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
pericardium edematous, abnormal WT + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
Fig. S11 from Astuti et al., 2012
pronephric duct opening morphology, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
pronephros development disrupted, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
trunk neural crest crestin expression increased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
whole organism ab3-gsk3b labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab1-dis3l2 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
whole organism Ab3-mek1 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism ab10-akt labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab3-casp9 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism cdkn1bb expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1ba expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism Ab15-casp3 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism foxo3a expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism ccnd1 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism Ab3-cdk1 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1a expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism bbc3 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism bcl2l11 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism viability, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
Phenotype of all Fish created by or utilizing MO1-dis3l2
Phenotype Fish Conditions Figures
midbrain hindbrain boundary morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
cranial neural crest twist1a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism bcl2l11 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
brain apoptotic process process quality, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary absence of anatomical entity, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
cranial cartilage morphology, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
brain deformed, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism viability, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
blastomere mitotic spindle ab3-tuba labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
cranial neural crest foxd3 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
blastomere spindle pole Ab8-tubg1 labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
brain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
eye deformed, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
midbrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
blastomere mitotic nuclear bridge increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
eye morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab3-cdk1 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
otic vesicle pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism cdkn1ba expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1a expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
neural tube apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
hindbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
forebrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
brain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
brain apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism Ab15-casp3 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
neural tube apoptotic process process quality, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
pericardium edematous, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
blastomere spindle pole distributed, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
neural crest sox10 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
forebrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
whole organism foxo3a expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism ab10-akt labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism ccnd1 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1bb expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism Ab1-dis3l2 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
eye pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
optic stalk pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
head decreased area, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
forebrain undulate, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
whole organism bbc3 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism Ab3-mek1 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism Ab3-casp9 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
blastomere metaphase chromosome alignment decreased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
trunk neural crest crestin expression increased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
eye fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism ab3-gsk3b labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
midbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with imageFig. 3 with image from D'Silva et al., 2025
hindbrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
blastomere mitotic spindle elongated, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
pronephros development disrupted, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
pronephric duct opening morphology, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
cloaca development disrupted, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
pericardium edematous, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
Citations