Morpholino
MO1-hace1
- ID
- ZDB-MRPHLNO-130913-1
- Name
- MO1-hace1
- Previous Names
-
- hace1-HECT (1)
- Target
- Sequence
-
5' - CCCTCGAACTGTTAGACAGAATAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hace1
No data available
Phenotype
Phenotype resulting from MO1-hace1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-hace1
1 - 5 of 19 Show all
Citations
- Razaghi, B., Steele, S.L., Prykhozhij, S.V., Stoyek, M.R., Hill, J.A., Cooper, M.D., McDonald, L., Lin, W., Daugaard, M., Crapoulet, N., Chacko, S., Lewis, S., Scott, I.C., Sorensen, P.H.B., Berman, J.N. (2017) hace1 influences zebrafish cardiac development via ROS-dependent mechanisms. Developmental Dynamics : an official publication of the American Association of Anatomists. 247(2):289-303
- Daugaard, M., Nitsch, R., Razaghi, B., McDonald, L., Jarrar, A., Torrino, S., Castillo-Lluva, S., Rotblat, B., Li, L., Malliri, A., Lemichez, E., Mettouchi, A., Berman, J.N., Penninger, J.M., and Sorensen, P.H. (2013) Hace1 controls ROS generation of vertebrate Rac1-dependent NADPH oxidase complexes. Nature communications. 4:2180
1 - 2 of 2
Show