Morpholino
MO2-tbx5b
- ID
- ZDB-MRPHLNO-130702-2
- Name
- MO2-tbx5b
- Previous Names
-
- tbx5bSD-MO (1)
- Target
- Sequence
-
5' - TTAAAAAACTAGGCACTCACCGGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbx5b
No data available
Phenotype
Phenotype resulting from MO2-tbx5b
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-tbx5b
1 - 5 of 11 Show all
Citations
- Chiavacci, E., D'Aurizio, R., Guzzolino, E., Russo, F., Baumgart, M., Groth, M., Mariani, L., D'Onofrio, M., Arisi, I., Pellegrini, M., Cellerino, A., Cremisi, F., Pitto, L. (2015) MicroRNA 19a replacement partially rescues fin and cardiac defects in zebrafish model of Holt Oram syndrome. Scientific Reports. 5:18240
- Pi-Roig, A., Martin-Blanco, E., Minguillón, C. (2014) Distinct tissue-specific requirements for the zebrafish tbx5 genes during heart, retina and pectoral fin development. Open Biology. 4:140014
- Parrie, L.E., Renfrew, E.M., Vander Wal, A., Mueller, R.L., and Garrity, D.M. (2013) Zebrafish tbx5 paralogs demonstrate independent essential requirements in cardiac and pectoral fin development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(5):485-502
1 - 3 of 3
Show