Morpholino
MO4-arxa
- ID
- ZDB-MRPHLNO-130327-2
- Name
- MO4-arxa
- Previous Names
-
- MoTarx (1)
- Target
- Sequence
-
5' - TCGTCGTCGTACTGACTGCTCATGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-arxa
No data available
Phenotype
Phenotype resulting from MO4-arxa
No data available
Phenotype of all Fish created by or utilizing MO4-arxa
1 - 5 of 8 Show all
Citations
- Ishibashi, M., Manning, E., Shoubridge, C., Krecsmarik, M., Hawkins, T.A., Giacomotto, J., Zhao, T., Mueller, T., Bader, P.I., Cheung, S.W., Stankiewicz, P., Bain, N.L., Hackett, A., Reddy, C.C., Mechaly, A.S., Peers, B., Wilson, S.W., Lenhard, B., Bally-Cuif, L., Gecz, J., Becker, T.S., Rinkwitz, S. (2015) Copy number variants in patients with intellectual disability affect the regulation of ARX transcription factor gene. Human genetics. 134(11-12):1163-82
- Djiotsa, J., Verbruggen, V., Giacomotto, J., Ishibashi, M., Manning, E., Rinkwitz, S., Manfroid, I., Lvoz, M., and Peers, B. (2012) Pax4 is not essential for beta-cell differentiation in zebrafish embryos but modulates alpha-cell generation by repressing arx gene expression. BMC Developmental Biology. 12(1):37
1 - 2 of 2
Show