Morpholino
MO2-popdc1
- ID
- ZDB-MRPHLNO-130116-1
- Name
- MO2-popdc1
- Previous Names
-
- MO2-bves
- Target
- Sequence
-
5' - AGAGCAGCCTGAAAGACAATAAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-popdc1
No data available
Phenotype
Phenotype resulting from MO2-popdc1
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO2-popdc1
1 - 5 of 23 Show all
Citations
- Wang, X., Tucker, N.R., Rizki, G., Mills, R., Krijger, P.H., de Wit, E., Subramanian, V., Bartell, E., Nguyen, X.X., Ye, J., Leyton-Mange, J., Dolmatova, E.V., van der Harst, P., de Laat, W., Ellinor, P.T., Newton-Cheh, C., Milan, D.J., Kellis, M., Boyer, L.A. (2016) Discovery and validation of sub-threshold genome-wide association study loci using epigenomic signatures. eLIFE. 5
- Wu, Y.C., Chen, R.F., Liu, C.Y., Hu, F.R., Huang, C.J., Wang, I.J. (2014) Knockdown of zebrafish blood vessel epicardial substance results in incomplete retinal lamination. TheScientificWorldJournal. 2014:803718
- Wu, Y.C., Liu, C.Y., Chen, Y.H., Chen, R.F., Sun, T.T., Huang, C.J., and Wang, I.J. (2012) Blood vessel epicardial substance (BVES) regulates epidermal tight junction integrity through atypical protein kinase C. The Journal of biological chemistry. 287(47):39887-39897
1 - 3 of 3
Show