Morpholino
MO2-flncb
- ID
- ZDB-MRPHLNO-121018-1
- Name
- MO2-flncb
- Previous Names
- None
- Target
- Sequence
-
5' - GAGTTTTCTAATGGCCCTTACCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-flncb
No data available
Phenotype
Phenotype resulting from MO2-flncb
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO2-flncb
1 - 5 of 31 Show all
Citations
- Begay, R.L., Tharp, C.A., Martin, A., Graw, S.L., Sinagra, G., Miani, D., Sweet, M.E., Slavov, D.B., Stafford, N., Zeller, M.J., Alnefaie, R., Rowland, T.J., Brun, F., Jones, K.L., Gowan, K., Mestroni, L., Garrity, D.M., Taylor, M.R. (2016) FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy.. JACC. Basic to translational science. 1:344-359
- Ruparelia, A.A., Oorschot, V., Ramm, G., Bryson-Richardson, R.J. (2016) FLNC myofibrillar myopathy results from impaired autophagy and protein insufficiency. Human molecular genetics. 25(11):2131-2142
- Ruparelia, A.A., Zhao, M., Currie, P.D., and Bryson-Richardson, R.J. (2012) Characterization and Investigation of zebrafish models of Filamin related myofibrillar myopathy. Human molecular genetics. 21(18):4073-4083
1 - 3 of 3
Show