Morpholino
MO1-atg5
- ID
- ZDB-MRPHLNO-121010-2
- Name
- MO1-atg5
- Previous Names
-
- 5MOatg5 (1)
- Target
- Sequence
-
5' - CATCCTTGTCATCTGCCATTATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atg5
No data available
Phenotype
Phenotype resulting from MO1-atg5
1 - 5 of 32 Show all
Phenotype of all Fish created by or utilizing MO1-atg5
1 - 5 of 56 Show all
Citations
- Giong, H.K., Hyeon, S.J., Lee, J.G., Cho, H.J., Park, U., Stein, T.D., Lee, J., Yu, K., Ryu, H., Lee, J.S. (2024) Tau accumulation is cleared by the induced expression of VCP via autophagy. Acta Neuropathologica. 148:4646
- Chen, X.K., Yi, Z.N., Lau, J.J., Ma, A.C. (2023) Distinct roles of core autophagy-related genes in zebrafish definitive hematopoiesis. Autophagy. 20(4):830-846
- Inoue, M., Miyahara, H., Shiraishi, H., Shimizu, N., Tsumori, M., Kiyota, K., Maeda, M., Umeda, R., Ishitani, T., Hanada, R., Ihara, K., Hanada, T. (2021) Leucyl-tRNA synthetase deficiency systemically induces excessive autophagy in zebrafish. Scientific Reports. 11:8392
- Masud, S., Prajsnar, T.K., Torraca, V., Lamers, G.E.M., Benning, M., Van Der Vaart, M., Meijer, A.H. (2019) Macrophages target Salmonella by Lc3-associated phagocytosis in a systemic infection model. Autophagy. 15(5):796-812
- Hu, Z.Y., Chen, B., Zhang, J.P., Ma, Y.Y. (2017) Up-regulation of autophagy-related gene 5 (ATG5) protects dopaminergic neurons in a zebrafish model of Parkinson's disease.. The Journal of biological chemistry. 292(44):18062-18074
- Mans, L.A., Querol Cano, L., van Pelt, J., Giardoglou, P., Keune, W.J., Haramis, A.G. (2017) The tumor suppressor LKB1 regulates starvation-induced autophagy under systemic metabolic stress. Scientific Reports. 7:7327
- Saera-Vila, A., Kish, P.E., Louie, K.W., Grzegorski, S.J., Klionsky, D.J., Kahana, A. (2016) Autophagy Regulates Cytoplasmic Remodeling During Cell Reprogramming in a Zebrafish Model of Muscle Regeneration. Autophagy. 12(10):1864-1875
- Boglev, Y., Badrock, A.P., Trotter, A.J., Du, Q., Richardson, E.J., Parslow, A.C., Markmiller, S.J., Hall, N.E., de Jong-Curtain, T.A., Ng, A.Y., Verkade, H., Ober, E.A., Field, H.A., Shin, D., Shin, C.H., Hannan, K.M., Hannan, R.D., Pearson, R.B., Kim, S.H., Ess, K.C., Lieschke, G.J., Stainier, D.Y., and Heath, J.K. (2013) Autophagy induction is a tor- and tp53-independent cell survival response in a zebrafish model of disrupted ribosome biogenesis. PLoS Genetics. 9(2):e1002379
- Hu, Z., Zhang, J., and Zhang, Q. (2011) Expression pattern and functions of autophagy-related gene atg5 in zebrafish organogenesis. Autophagy. 7(12):1514-1527
1 - 9 of 9
Show