Morpholino
MO1-caspa
- ID
- ZDB-MRPHLNO-120808-1
- Name
- MO1-caspa
- Previous Names
- None
- Target
- Sequence
-
5' - GCCATGTTTAGCTCAGGGCGCTGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-caspa
No data available
Phenotype
Phenotype resulting from MO1-caspa
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-caspa
1 - 5 of 14 Show all
Citations
- Frame, J.M., Kubaczka, C., Long, T.L., Esain, V., Soto, R.A., Hachimi, M., Jing, R., Shwartz, A., Goessling, W., Daley, G.Q., North, T.E. (2020) Metabolic Regulation of Inflammasome Activity Controls Embryonic Hematopoietic Stem and Progenitor Cell Production. Developmental Cell. 55(2):133-149.e6
- Zhang, R., Varela, M., Forn-Cuní, G., Torraca, V., van der Vaart, M., Meijer, A.H. (2020) Deficiency in the autophagy modulator Dram1 exacerbates pyroptotic cell death of Mycobacteria-infected macrophages. Cell Death & Disease. 11:277
- Tan, J., Yang, D., Wang, Z., Zheng, X., Zhang, Y., Liu, Q. (2019) EvpP inhibits neutrophils recruitment via Jnk-caspy inflammasome signaling in vivo. Fish & shellfish immunology. 92:851-860
- Vincent, W.J., Freisinger, C.M., Lam, P.Y., Huttenlocher, A., Sauer, J.D. (2016) Macrophages mediate flagellin induced inflammasome activation and host defense in zebrafish. Cellular Microbiology. 18(4):591-604
- Masumoto, J., Zhou, W., Chen, F.F., Su, F., Kuwada, J.Y., Hidaka, E., Katsuyama, T., Sagara, J., Taniguchi, S., Ngo-Hazelett, P., Postlethwait, J.H., Nuñez, G., and Inohara, N. (2003) Caspy: A Zebrafish caspase activated by ASC oligomerization required for pharyngeal arch development. The Journal of biological chemistry. 278(6):4268-4276
1 - 5 of 5
Show