Morpholino
MO5-rp2
- ID
- ZDB-MRPHLNO-120222-9
- Name
- MO5-rp2
- Previous Names
-
- MO_Spl (1)
- Target
- Sequence
-
5' - GCGTCACAAATAAGTTCTAACCTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-rp2
No data available
Phenotype
Phenotype resulting from MO5-rp2
| Phenotype | Fish | Figures |
|---|---|---|
| brain hydrocephalic, abnormal | AB + MO5-rp2 |
Fig. 6
from Desvignes et al., 2015 |
| pericardium edematous, abnormal | AB + MO5-rp2 |
Fig. 6
from Desvignes et al., 2015 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO5-rp2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| pericardium edematous, abnormal | AB + MO5-rp2 | standard conditions |
Fig. 6
from Desvignes et al., 2015 |
| brain hydrocephalic, abnormal | AB + MO5-rp2 | standard conditions |
Fig. 6
from Desvignes et al., 2015 |
1 - 2 of 2
Citations
- Desvignes, T., Nguyen, T., Chesnel, F., Bouleau, A., Fauvel, C., Bobe, J. (2015) X-linked Retinitis Pigmentosa 2 Is a Novel Maternal-Effect Gene Required for Left-Right Asymmetry in Zebrafish. Biology of reproduction. 93(2):42
- Shu, X., Zeng, Z., Gautier, P., Lennon, A., Gakovic, M., Cheetham, M.E., Patton, E.E., and Wright, A.F. (2011) Knock-down of the Zebrafish Orthologue of the Retinitis Pigmentosa 2 (RP2) Gene Results in Retinal Degeneration. Investigative ophthalmology & visual science. 52(6):2960-6
1 - 2 of 2
Show