Morpholino
MO3-nos2a
- ID
- ZDB-MRPHLNO-120213-1
- Name
- MO3-nos2a
- Previous Names
- None
- Target
- Sequence
-
5' - ACAGTTTAAAAGTACCTTAGCCGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nos2a
No data available
Phenotype
Phenotype resulting from MO3-nos2a
No data available
Phenotype of all Fish created by or utilizing MO3-nos2a
from 1 - 2 of 2
Citations
- Peng, G., Montenegro, M.F., Ntola, C.N.M., Vranic, S., Kostarelos, K., Vogt, C., Toprak, M.S., Duan, T., Leifer, K., Bräutigam, L., Lundberg, J.O., Fadeel, B. (2020) Nitric oxide-dependent biodegradation of graphene oxide reduces inflammation in the gastrointestinal tract. Nanoscale. 12(32):16730-16737
- Veetil, A.T., Zou, J., Henderson, K.W., Jani, M.S., Shaik, S.M., Sisodia, S.S., Hale, M.E., Krishnan, Y. (2020) DNA-based fluorescent probes of NOS2 activity in live brains. Proceedings of the National Academy of Sciences of the United States of America. 117(26):14694-14702
- Wittmann, C., Reischl, M., Shah, A.H., Kronfuss, E., Mikut, R., Liebel, U., Grabher, C. (2015) A Zebrafish Drug-Repurposing Screen Reveals sGC-Dependent and sGC-Independent Pro-Inflammatory Activities of Nitric Oxide. PLoS One. 10:e0137286
- Elks, P.M., Brizee, S., van der Vaart, M., Walmsley, S.R., van Eeden, F.J., Renshaw, S.A., and Meijer, A.H. (2013) Hypoxia inducible factor signaling modulates susceptibility to mycobacterial infection via a nitric oxide dependent mechanism. PLoS pathogens. 9(12):e1003789
- Palha, N., Guivel-Benhassine, F., Briolat, V., Lutfalla, G., Sourisseau, M., Ellett, F., Wang, C.H., Lieschke, G.J., Herbomel, P., Schwartz, O., and Levraud, J.P. (2013) Real-time whole-body visualization of chikungunya virus infection and host interferon response in zebrafish. PLoS pathogens. 9(9):e1003619
- Hall, C.J., Flores, M.V., Oehlers, S.H., Sanderson, L.E., Lam, E.Y., Crosier, K.E., and Crosier, P.S. (2012) Infection-Responsive Expansion of the Hematopoietic Stem and Progenitor Cell Compartment in Zebrafish Is Dependent upon Inducible Nitric Oxide. Cell Stem Cell. 10(2):198-209
1 - 6 of 6
Show