Morpholino
MO1-nipblb
- ID
- ZDB-MRPHLNO-111201-1
- Name
- MO1-nipblb
- Previous Names
-
- nipbla-MO1 (1)
- Target
- Sequence
-
5' - ACGTGGACGCACAGGTTGCTCAGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nipblb
No data available
Phenotype
Phenotype resulting from MO1-nipblb
No data available
Phenotype of all Fish created by or utilizing MO1-nipblb
1 - 5 of 65 Show all
Citations
- Kawauchi, S., Santos, R., Muto, A., Lopez-Burks, M.E., Schilling, T.F., Lander, A.D., Calof, A.L. (2016) Using mouse and zebrafish models to understand the etiology of developmental defects in Cornelia de Lange Syndrome. American journal of medical genetics. Part C, Seminars in medical genetics. 172(2):138-45
- Xu, B., Sowa, N., Cardenas, M.E., Gerton, J.L. (2015) L-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome. Human molecular genetics. 24(6):1540-55
- Muto, A., Ikeda, S., Lopez-Burks, M.E., Kikuchi, Y., Calof, A.L., Lander, A.D., Schilling, T.F. (2014) Nipbl and Mediator Cooperatively Regulate Gene Expression to Control Limb Development. PLoS Genetics. 10:e1004671
- Muto, A., Calof, A.L., Lander, A.D., and Schilling, T.F. (2011) Multifactorial Origins of Heart and Gut Defects in nipbl-Deficient Zebrafish, a Model of Cornelia de Lange Syndrome. PLoS Biology. 9(10):e1001181
1 - 4 of 4
Show