Morpholino

MO2-chd7

ID
ZDB-MRPHLNO-111012-2
Name
MO2-chd7
Previous Names
None
Target
Sequence
5' - TTATTTTCTGGCACTAACCATGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chd7
No data available
Phenotype
Phenotype resulting from MO2-chd7
Phenotype Fish Figures
brain morphology, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal fin morphology, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
caudal hematopoietic tissue EGFP expression increased amount, abnormal hkz04tTg + MO2-chd7 Fig. S3 from Liu et al., 2018
caudal hematopoietic tissue myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage mfap4.1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue myeloid lineage restricted progenitor cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil mpx expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
cranial cartilage malformed, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
eye decreased size, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
eye morphology, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
head flattened, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
heart morphology, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
heart looping disrupted, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
otic vesicle lacks parts or has fewer parts of type otolith, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith amount, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
otolith decreased size, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith fused with otolith, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith development process quality, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
pericardium edematous, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 4 dlx2a expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 4 hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 5 hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal pouch zn-5 labeling decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 2 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 3 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 4 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 5 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharynx bmp4 expression decreased amount, abnormal AB + MO2-chd7 Fig. 8 from Liu et al., 2018
pharynx bmp2b expression decreased amount, abnormal AB + MO2-chd7 Fig. 8 from Liu et al., 2018
pharynx hypotrophic, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharynx cell population proliferation decreased process quality, abnormal AB + MO2-chd7 Fig. 6 from Liu et al., 2018
T cell migration decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus foxn1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
thymus GFP expression decreased amount, abnormal zdf8Tg + MO2-chd7 Fig. 1,  Fig. 7 from Liu et al., 2018
thymus myb expression decreased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
thymus EGFP expression decreased amount, abnormal hkz04tTg + MO2-chd7 Fig. 6,  Fig. S3 from Liu et al., 2018
thymus rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 7 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal hkz04tTg + MO2-chd7 Fig. 6 from Liu et al., 2018
thymus cell population proliferation decreased process quality, abnormal AB + MO2-chd7 Fig. 6 from Liu et al., 2018
thymus T cell ikzf1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus T cell decreased amount, abnormal zdf8Tg + MO2-chd7 Fig. 1,  Fig. 2 from Liu et al., 2018
thymus T cell rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus T cell il7r expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus epithelium morphogenesis disrupted, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
thymus primordium ccl25a expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium ccl25b expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium lymphoid progenitor cell EGFP expression decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2,  Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism il7r expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
whole organism rag2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 7 from Liu et al., 2018
whole organism rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1,  Fig. 7 from Liu et al., 2018
whole organism ikzf1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
whole organism ccl25a expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
whole organism ccl25b expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
whole organism foxn1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
whole organism ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism mfap4.1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism mpx expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism anterior-posterior axis curved, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism anterior-posterior axis kinked, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
Phenotype of all Fish created by or utilizing MO2-chd7
Phenotype Fish Conditions Figures
pharynx hypotrophic, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
pharynx bmp2b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 8 from Liu et al., 2018
pharyngeal arch 4 dlx2a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal pouch 2 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal fin morphology, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
pharynx cell population proliferation decreased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal hematopoietic tissue neutrophil mpx expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus foxn1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
heart morphology, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
thymus T cell rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
whole organism ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
thymus primordium ccl25a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism mfap4.1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus epithelium morphogenesis disrupted, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
caudal hematopoietic tissue myeloid lineage restricted progenitor cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch 4 hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus T cell decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1,  Fig. 2 from Liu et al., 2018
thymus cell population proliferation decreased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
thymus T cell il7r expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
pharyngeal pouch 4 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
otolith amount, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
head flattened, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal hematopoietic tissue neutrophil increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
heart looping disrupted, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
cranial cartilage malformed, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
whole organism anterior-posterior axis curved, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal hematopoietic tissue myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism il7r expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
pharyngeal pouch 5 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism ccl25b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
eye morphology, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
thymus primordium ccl25b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
whole organism ikzf1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
eye decreased size, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
whole organism mpx expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1,  Fig. 7 from Liu et al., 2018
thymus myb expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch 5 hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
brain morphology, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism ccl25a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue macrophage mfap4.1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal pouch zn-5 labeling decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism rag2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 7 from Liu et al., 2018
pharynx bmp4 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 8 from Liu et al., 2018
thymus T cell ikzf1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism foxn1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
pharyngeal pouch 3 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism anterior-posterior axis kinked, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 7 from Liu et al., 2018
pericardium edematous, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
otolith decreased size, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otic vesicle lacks parts or has fewer parts of type otolith, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otolith fused with otolith, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otolith development process quality, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
caudal hematopoietic tissue EGFP expression increased amount, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. S3 from Liu et al., 2018
thymus EGFP expression decreased amount, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. 6,  Fig. S3 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus T cell decreased amount, abnormal zdf8Tg + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
thymus GFP expression decreased amount, abnormal zdf8Tg + MO2-chd7 standard conditions Fig. 1,  Fig. 7 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell EGFP expression decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
T cell migration decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.