Morpholino
MO2-chd7
- ID
- ZDB-MRPHLNO-111012-2
- Name
- MO2-chd7
- Previous Names
- None
- Target
- Sequence
-
5' - TTATTTTCTGGCACTAACCATGTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chd7
No data available
Phenotype
Phenotype resulting from MO2-chd7
1 - 5 of 76 Show all
Phenotype of all Fish created by or utilizing MO2-chd7
1 - 5 of 83 Show all
Citations
- Liu, Z.Z., Wang, Z.L., Choi, T.I., Huang, W.T., Wang, H.T., Han, Y.Y., Zhu, L.Y., Kim, H.T., Choi, J.H., Lee, J.S., Kim, H.G., Zhao, J., Chen, Y., Lu, Z., Tian, X.L., Pan, B.X., Li, B.M., Kim, C.H., Xu, H. (2018) Chd7 Is Critical for Early T-Cell Development and Thymus Organogenesis in Zebrafish. The American journal of pathology. 188(4):1043-1058
- Balasubramanian, R., Choi, J.H., Francescatto, L., Willer, J., Horton, E.R., Asimacopoulos, E.P., Stankovic, K.M., Plummer, L., Buck, C.L., Quinton, R., Nebesio, T.D., Mericq, V., Merino, P.M., Meyer, B.F., Monies, D., Gusella, J.F., Al Tassan, N., Katsanis, N., Crowley, W.F. (2014) Functionally compromised CHD7 alleles in patients with isolated GnRH deficiency. Proceedings of the National Academy of Sciences of the United States of America. 111(50):17953-8
- Patten, S.A., Jacobs-McDaniels, N.L., Zaouter, C., Drapeau, P., Albertson, R.C., and Moldovan, F. (2012) Role of Chd7 in Zebrafish: A Model for CHARGE Syndrome. PLoS One. 7(2):e31650
- Jacobs-McDaniels, N.L., and Albertson, R.C. (2011) Chd7 plays a critical role in controlling left-right symmetry during zebrafish somitogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(10):2272-80
1 - 4 of 4
Show