Morpholino
MO5-efnb2a
- ID
- ZDB-MRPHLNO-111007-1
- Name
- MO5-efnb2a
- Previous Names
- None
- Target
- Sequence
-
5' - TTGCCGCCTCGCGCACTTACTTGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO. The published morpholino sequence contains a typo. The author was contacted and they provided the correct sequence.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-efnb2a
No data available
Phenotype
Phenotype resulting from MO5-efnb2a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO5-efnb2a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
heart nrg1 expression decreased amount, abnormal | twu26Tg + MO5-efnb2a | control |
Fig. 4 ![]() |
heart efnb2a expression decreased amount, abnormal | twu26Tg + MO5-efnb2a | control |
Fig. 4 ![]() |
trabecular layer absent, abnormal | s843Tg; vc6Tg + MO5-efnb2a | control |
Fig. 4 ![]() |
1 - 3 of 3
Citations
- Samsa, L.A., Givens, C., Tzima, E., Stainier, D.Y., Qian, L., Liu, J. (2015) Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development (Cambridge, England). 142:4080-91
- Wang, Y., Nakayama, M., Pitulescu, M.E., Schmidt, T.S., Bochenek, M.L., Sakakibara, A., Adams, S., Davy, A., Deutsch, U., Lüthi, U., Barberis, A., Benjamin, L.E., Mäkinen, T., Nobes, C.D., and Adams, R.H. (2010) Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis. Nature. 465(7297):483-486
1 - 2 of 2
Show