Morpholino
MO1-lin28ab
- ID
- ZDB-MRPHLNO-110913-1
- Name
- MO1-lin28ab
- Previous Names
-
- MO1-lin28a
- Target
- Sequence
-
5' - GGGCATCTTTATGATTTAGCCTTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lin28ab
No data available
Phenotype
Phenotype resulting from MO1-lin28ab
| Phenotype | Fish | Figures |
|---|---|---|
| glial cell proliferation decreased process quality, abnormal | mi4Tg + MO1-lin28ab |
Fig. 2
from Ramachandran et al., 2010 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-lin28ab
from 1 - 2 of 2
Citations
- Kaur, S., Gupta, S., Chaudhary, M., Khursheed, M.A., Mitra, S., Kurup, A.J., Ramachandran, R. (2018) let-7 MicroRNA-Mediated Regulation of Shh Signaling and the Gene Regulatory Network Is Essential for Retina Regeneration. Cell Reports. 23:1409-1423
- Powell, C., Elsaeidi, F., and Goldman, D. (2012) Injury-Dependent Muller Glia and Ganglion Cell Reprogramming during Tissue Regeneration Requires Apobec2a and Apobec2b. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(3):1096-1109
- Ramachandran, R., Zhao, X.F., and Goldman, D. (2011) Ascl1a/Dkk/ beta -catenin signaling pathway is necessary and glycogen synthase kinase-3 beta inhibition is sufficient for zebrafish retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 108(38):15858-63
- Ramachandran, R., Fausett, B.V., and Goldman, D. (2010) Ascl1a regulates Müller glia dedifferentiation and retinal regeneration through a Lin-28-dependent, let-7 microRNA signalling pathway. Nature cell biology. 12(11):1101-1107
1 - 4 of 4
Show