Morpholino
MO1-nphp1
- ID
- ZDB-MRPHLNO-110908-3
- Name
- MO1-nphp1
- Previous Names
-
- nphp1 ATG (1)
- MO1-zgc:152930
- Target
- Sequence
-
5' - CCCTCTTCTCTTTGGAGGCATGTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp1
No data available
Phenotype
Phenotype resulting from MO1-nphp1
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-nphp1
1 - 5 of 19 Show all
Citations
- Wang, H., Zaiser, F., Eckert, P., Ruf, J., Kayser, N., Veenstra, A.C., Müller, M., Haas, R., Walz, G., Yakulov, T.A. (2023) Inversin (NPHP2) and Vangl2 are required for normal zebrafish cloaca formation. Biochemical and Biophysical Research Communications. 673:9159-15
- Kayser, N., Zaiser, F., Veenstra, A.C., Wang, H., Göcmen, B., Eckert, P., Franz, H., Köttgen, A., Walz, G., Yakulov, T.A. (2022) Clock genes rescue nphp mutations in zebrafish. Human molecular genetics. 31(24):4143-4158
- Viau, A., Bienaimé, F., Lukas, K., Todkar, A.P., Knoll, M., Yakulov, T.A., Hofherr, A., Kretz, O., Helmstädter, M., Reichardt, W., Braeg, S., Aschman, T., Merkle, A., Pfeifer, D., Dumit, V.I., Gubler, M.C., Nitschke, R., Huber, T.B., Terzi, F., Dengjel, J., Grahammer, F., Köttgen, M., Busch, H., Boerries, M., Walz, G., Triantafyllopoulou, A., Kuehn, E.W. (2018) Cilia-localized LKB1 regulates chemokine signaling, macrophage recruitment, and tissue homeostasis in the kidney. The EMBO journal. 37(15)
- Lindstrand, A., Davis, E.E., Carvalho, C.M., Pehlivan, D., Willer, J.R., Tsai, I.C., Ramanathan, S., Zuppan, C., Sabo, A., Muzny, D., Gibbs, R., Liu, P., Lewis, R.A., Banin, E., Lupski, J.R., Clark, R., Katsanis, N. (2014) Recurrent CNVs and SNVs at the NPHP1 Locus Contribute Pathogenic Alleles to Bardet-Biedl Syndrome. American journal of human genetics. 94:745-54
- Slanchev, K., Pütz, M., Schmitt, A., Kramer-Zucker, A., and Walz, G. (2011) Nephrocystin-4 is required for pronephric duct-dependent cloaca formation in zebrafish. Human molecular genetics. 20(16):3119-28
1 - 5 of 5
Show