Morpholino

MO2-esr2a

ID
ZDB-MRPHLNO-110822-1
Name
MO2-esr2a
Previous Names
None
Target
Sequence
5' - TGTCTCCTTCGGGATACTCGGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-esr2a
No data available
Phenotype
Phenotype resulting from MO2-esr2a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
brain apoptotic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
ceratohyal cartilage orientation basibranchial, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
epithelium ventral region hypertrophic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
extension edematous, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
Meckel's cartilage stubby, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
palatoquadrate cartilage bent, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal y1Tg + MO2-esr2a Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
whole organism apoptotic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
Phenotype of all Fish created by or utilizing MO2-esr2a
Phenotype Fish Conditions Figures
extension edematous, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
Meckel's cartilage stubby, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism apoptotic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
epithelium ventral region hypertrophic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
palatoquadrate cartilage bent, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
brain apoptotic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
ceratohyal cartilage orientation basibranchial, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal y1Tg + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal y1Tg + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
Citations