Morpholino
MO1-irx3b
- ID
- ZDB-MRPHLNO-110815-1
- Name
- MO1-irx3b
- Previous Names
- None
- Target
- Sequence
-
5' - ACCGGGAGGACTGCGGGGAAACTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irx3b
No data available
Phenotype
Phenotype resulting from MO1-irx3b
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-irx3b
1 - 5 of 27 Show all
Citations
- Naylor, R.W., Chang, H.G., Qubisi, S., Davidson, A.J. (2018) A novel mechanism of gland formation in zebrafish involving transdifferentiation of renal epithelial cells and live cell extrusion. eLIFE. 7:
- Marra, A.N., Wingert, R.A. (2014) Roles of Iroquois Transcription Factors in Kidney Development. Cell & developmental biology. 3(1):1000131
- Naylor, R.W., Przepiorski, A., Ren, Q., Yu, J., and Davidson, A.J. (2013) HNF1beta Is Essential for Nephron Segmentation during Nephrogenesis. Journal of the American Society of Nephrology : JASN. 24(1):77-87
- Wingert, R.A., and Davidson, A.J. (2011) Zebrafish nephrogenesis involves dynamic spatiotemporal expression changes in renal progenitors and essential signals from retinoic acid and irx3b. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(8):2011-2027
1 - 4 of 4
Show