Morpholino
MO2-ltbp3
- ID
- ZDB-MRPHLNO-110801-4
- Name
- MO2-ltbp3
- Previous Names
-
- MOspl (1)
- Target
- Sequence
-
5' - ACCACCTGGACAGATACATTTATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to second-intron splice acceptor sequence
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ltbp3
No data available
Phenotype
Phenotype resulting from MO2-ltbp3
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO2-ltbp3
1 - 5 of 21 Show all
Citations
- Gays, D., Hess, C., Camporeale, A., Ala, U., Provero, P., Mosimann, C., Santoro, M.M. (2017) An exclusive cellular and molecular network governs intestinal smooth muscle cell differentiation in vertebrates. Development (Cambridge, England). 144(3):464-478
- Guner-Ataman, B., Paffett-Lugassy, N., Adams, M.S., Nevis, K.R., Jahangiri, L., Obregon, P., Kikuchi, K., Poss, K.D., Burns, C.E., and Burns, C.G. (2013) Zebrafish second heart field development relies on progenitor specification in anterior lateral plate mesoderm and nkx2.5 function. Development (Cambridge, England). 140(6):1353-1363
- Opitz, R., Maquet, E., Huisken, J., Antonica, F., Trubiroha, A., Pottier, G., Janssens, V., and Costagliola, S. (2012) Transgenic zebrafish illuminate the dynamics of thyroid morphogenesis and its relationship to cardiovascular development. Developmental Biology. 372(2):203-216
- Zhou, Y., Cashman, T.J., Nevis, K.R., Obregon, P., Carney, S.A., Liu, Y., Gu, A., Mosimann, C., Sondalle, S., Peterson, R.E., Heideman, W., Burns, C.E., and Burns, C.G. (2011) Latent TGF-β binding protein 3 identifies a second heart field in zebrafish. Nature. 474(7353):645-8
1 - 4 of 4
Show