Morpholino
MO1-tbx2
- ID
- ZDB-MRPHLNO-110718-2
- Name
- MO1-tbx2
- Previous Names
-
- MO2ab (1)
- Targets
- Sequence
-
5' - AAAACTGGATCTCTCATCGGTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation-blocking MO that targets the translation start sites of both tbx2a and tbx2b.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx2
No data available
Phenotype
Phenotype resulting from MO1-tbx2
No data available
Phenotype of all Fish created by or utilizing MO1-tbx2
1 - 5 of 19 Show all
Citations
- Morales, E.E., Handa, N., Drummond, B.E., Chambers, J.M., Marra, A.N., Addiego, A., Wingert, R.A. (2018) Homeogene emx1 is required for nephron distal segment development in zebrafish. Scientific Reports. 8:18038
- Drummond, B.E., Li, Y., Marra, A.N., Cheng, C.N., Wingert, R.A. (2017) The tbx2a/b transcription factors direct pronephros segmentation and corpuscle of Stannius formation in zebrafish. Developmental Biology. 421(1):52-66
- Sedletcaia, A., and Evans, T. (2011) Heart chamber size in zebrafish is regulated redundantly by duplicated tbx2 genes. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(6):1548-1557
1 - 3 of 3
Show